We narrowed to 17,757 results for: puro
-
Plasmid#162089PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to StrepTagII-ProtC-HA
UseLentiviralTagsStrepTagII-ProtC-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEpicVector3G_Puro-T2A-EGFP-VSVg-StrepTagII-HA
Plasmid#162080PurposeEGFP linked to 3 tags on the C-terminus as barcodes. Puromycin resistant.DepositorInsertPuromycin resistant; EGFP linked to VSVg-StrepTagII-HA
UseLentiviralTagsVSVg-StrepTagII-HAMutationWTPromoterEF1AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-mgp100-PuroR [M1G]
Plasmid#171802PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
M78 pIRESpuro-CBP-2xTEV-StrepTag
Plasmid#17132DepositorTypeEmpty backboneTags2xTEV, CBP, and StreptavidinExpressionMammalianAvailable SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-GFP-miRE_shSCR-Puro
Plasmid#135689PurposeConstitutive expression (CMV promoter) of GFP cDNA plus miRE-embedded scrambled control shRNA, Puromycin selectionDepositorInsertshScrambled
UseLentiviralAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1_EF1a-MitoTrap-mCherry-IRES-Puro
Plasmid#197067PurposeDonor plasmid for human AAVS1 locus knock-in, constitutive expression of MitoTrap-mCherryDepositorInsertMitoTrap-mCherry
UseCRISPRExpressionMammalianAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lv EF1a HP1cs-Frb1x PGK Puro
Plasmid#102808PurposeLentiviral plasmid from FIRE-Cas9 system to express HP1cs-Frb1x fusion proteinDepositorInsertHP1cs-Frb1x
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBABE-2XFLAG,2XHA-CyclinF-puro
Plasmid#32976DepositorAvailable SinceFeb. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
911 pBabe puroL PTEN G129E
Plasmid#10771DepositorAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FLAG-NRASQ61K-IRES-Puro
Plasmid#120575PurposeExpresses Flag-N-Ras Q61K fusion protein in mammalian cells & for virus productionDepositorAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND3-Puro
Plasmid#172619PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D3 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVSP6-NR2F2-SV40-PURO
Plasmid#138361PurposeLentiviral plasmid contains human NR2F2 driven by CMVSP6 and puromycin resistance for selectionDepositorInsertHuman NR2F2, with puromycin driven by SV40 for selection
ExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
ePB-PURO-FLAG-METTL3-APPA
Plasmid#160253PurposeFor stable integration of catalytic inactive FLAG-METTL3 in human cells with trasposaseDepositorInsertmethyltransferase like 3 (METTL3 Human)
TagsFLAGExpressionMammalianMutationchanges in aa 395–398, DPPW → APPAPromotertight TRE promoterAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DHFR.dn-cHSF1
Plasmid#134729PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_hPGK1_hGEM(1-110)_mNG_hSLBP(18-108)_FS
Plasmid#191527PurposeDonor for targeted integration of 3xFLAG-2xSTREP tagged S-phase specific probe (FUCCI-S) to the AAVS1 safe harbor locusDepositorInserthGEM(1-110)_mNG_hSLBP(18-108)
UseCRISPR and Synthetic BiologyTagsmNeonGreen (mNG) + 3xFLAG_TwinStrepExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CSNK1A1 G40N-Puro
Plasmid#123320PurposeLentiviral vector for expression of Flag tagged CK1alpha G40N-P2A-Puro casette from a CMV promoterDepositorInsertCSNK1A1 (CSNK1A1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Glycine 40 to AsparaginePromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only