We narrowed to 6,012 results for: ATC
-
Plasmid#1107DepositorInsertc-src
ExpressionYeastMutationMET3 promoter inserted in EcoRI and BamHI of pRS3…Available SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2M1
Plasmid#202758PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2M1DepositorInsertgRNA targeting AP2M1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NRF2
Plasmid#214692PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human NRF2DepositorInsertdgRNA_NRF2 (NFE2L2 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB ωRNA-v2
Plasmid#220958Purposehuman U6-driven expression of ωRNA-v2 scaffold with BsmBI for guide cloingDepositorInsertOgeuIscB-ωRNA-v2 scaffold with BsmBI for guide cloning
UseCRISPRExpressionMammalianAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
msHook2 g2 lentiCRISPRv2-mCherry
Plasmid#218653PurposeKnockout vector for mouse Hook2DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC6L gRNA1
Plasmid#211632PurposesgRNA-1 against ERCC6LDepositorInsertsgRNA ERCC6L
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTatABmNeonC
Plasmid#178464PurposepTatABC with an mNeonGreen fluorescent protein tag at the C-terminal end of TatB.DepositorInsertTatA, TatBmNeon, TatC
TagsmNeonGreen fused to TatBExpressionBacterialPromoteraraCAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBAD_TatABmCherryC
Plasmid#178545PurposepTatABC with an mCherry fluorescent protein tag at the end of TatB.DepositorInsertTatA, TatBmCherry, TatC
TagsmCherry fused to TatBExpressionBacterialPromoteraraCAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-gR085
Plasmid#188554PurposeBinary vector for CRISPR/Cas9 targeted to MpIGPD in Marchantia polymorpha (for Agrobacterium-mediated genetic transformation)DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-gR085
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorAvailable SinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
RS314-U6(PolII-Lsm)
Plasmid#200772PurposePol II expression of U6 LsmDepositorInsertGal-SNR6-II
ExpressionBacterial and YeastAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBZS-YP_001426521
Plasmid#198363PurposeExpress YP_001426521 in bacterial cells.DepositorInsertYP_001426521 (Z040R )
ExpressionBacterialAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
AatII-pRPS5A-PTP-3Xflag- psa A Right _G1397C_ABE
Plasmid#189648Purposepsa A Right _G1397C_ABEDepositorInsertTALE and DddAtox and TadA 8e
UseTALENExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPS5A-PTP-3Xflag-rbc L 294 Left_G1397 C-ABE
Plasmid#189650Purposerbc L 294 Left_G1397 C-ABEDepositorInsertTALE and DddAtox and TadA 8e
UseTALENExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6-U57A
Plasmid#169927PurposeWT U6 with a U57A mutationDepositorInsertU6 U57A
ExpressionBacterial and YeastAvailable SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-Rictor-shRNA
Plasmid#157930PurposeKnockdown of RictorDepositorInsertRictor shRNA
UseLentiviral and RNAiTagstdTomatoPromotermouse U6Available SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSUI-SynP-CAS2sg
Plasmid#154342PurposeExpression of the sgRNA targeting to the E. coli can geneDepositorInsertCAS2 sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZHX3_iso1_1
Plasmid#128249PurposeEncodes gRNA for 3' target of human ZHX3_iso1DepositorInsertZHX3_iso1 gRNA
UseCRISPRAvailable SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only