We narrowed to 4,536 results for: Bre;
-
Plasmid#64680Purposeexpresses siRNA resistant WRAP53betaDepositorInsertWD40-encoding RNA antisense to P53 (WRAP53 Human)
TagsFLAGExpressionMammalianMutationsiRNA resistantPromoterCMVAvailable SinceMay 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-Gb2-K
Plasmid#25759PurposeEntry vector with human U6 promoter driving both mouse G alpha 12 and G alpha 13 miR30-based shRNAs.DepositorInsertGb2 miR-shRNA (Gnb2 Mouse)
UseEntry vectorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEN_TTmiRc2_BirA_NRF2
Plasmid#136524PurposeUsed as a donor vector to clone into pSLIKDepositorInsertNRF2 (NFE2L2 Human)
UseEntry vector for gateway cloningAvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2
Plasmid#132775PurposePrime editing in mammalian cells. This plasmid is used by PE2, PE3, and PE3bDepositorInsertPE2
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA ADAR1 p110
Plasmid#237854PurposeLentiviral vector expressing ADAR1 p110DepositorAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRN120
Plasmid#160696PurposeBeYDV viral replicon on T-DNA backbone expressing Firefly Luc+, CmYLCV::STM::35S terminator, Nos::WUS2::PinII terminatorDepositorInsertsCmYLCV::Luc+::AtHSP
Nos::WUS2::PinII
AtUbi10::STM::35S
UseLuciferase; Gemini viral replicon, plant developm…PromoterAtUbi10, CmYLCV, and NosAvailable SinceNov. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO-sgRNA-puro
Plasmid#104321Purpose3rd generation lentiviral plasmid for inducible expression of sgRNA; derived from tet-pLKO-puro; puromycin selection. See manual for detailed protocols.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterH1/TOAvailable SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-ER WT
Plasmid#49498PurposeExpresses HA-tagged ER wild-type in mammalian cellsDepositorAvailable SinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRRL-CAG-NR5A1-FLAG
Plasmid#242229PurposeExpression of full-length human SF-1 using lentivirusDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-GFP [N86/38.1R]
Plasmid#114492PurposeMammalian Expression Plasmid of anti-GFP. Derived from hybridoma N86/38.1.DepositorInsertanti-GFP (Aequorea victoria) recombinant mouse monoclonal antibody
ExpressionMammalianPromoterdual CMVAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-GFP
Plasmid#132776PurposePrime editing in mammalian cells with co-translational GFP expressionDepositorInsertPE2-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-Puro-mCherry2
Plasmid#219679PurposeCROPseq vector based on #86708 with an additional mCherry2 fluorescent geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEF1a-Puro-P2A-mCherry2-WPRE-hU6-gRNAExpressionMammalianAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSW002-Pc-TorA(sp)-mNeonGreen
Plasmid#205020PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorA signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorA-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-zeo
Plasmid#160091PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and zeocin resistance markerDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-21a_3xNLS_SpCas9_protein_expression
Plasmid#114365PurposeProtein expression plasmid for 3xNLS SpCas9 in pET-21a backboneDepositorInsert3xNLS_SpCas9
UseCRISPRTagsNLSExpressionBacterialPromoterT7Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_IRES_GFP_CD16a
Plasmid#196189PurposeRetroviral expression plasmid for generating stable FCGR3A (CD16a)-expressing cell lines.DepositorInsertCD16a (FCGR3A Human)
UseRetroviralExpressionMammalianMutationchanged Phenylalanine 158 to ValinePromoterLTRAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-NR5A1-FLAG
Plasmid#242227PurposeExpression of full-length human SF-1 using piggyBac transpositionDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE3G-FNLS-PGK-Puro
Plasmid#110847PurposeLentiviral vector for dox-inducible expression of FNLS in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterTRE3GAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-RIGI-Apex- T2A-EGFP
Plasmid#167288PurposeLentiviral expression plasmid encoding an APEX2 RIG-I fusion product in frame with a self-cleaving eGFP. APEX biotin ligase can biotynilate RNAs in proximity of the RLR RIG-I sensor.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only