We narrowed to 62,913 results for: cloning
-
Plasmid#183951PurposeInducible lentiviral expression, TRE-control-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTADepositorAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978)
Plasmid#185910PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorInserthuman codon optimized ABE8e-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDH-EF1-Large BiT - SNAP-tag - Beta-actin
Plasmid#171019PurposeLentiviral expression of a Large BiT-SNAP-tag-Beta-actin fusion in mammalian cellsDepositorInsertLargeBit-SNAPtag- Beta-actin
UseLentiviral and LuciferaseTagsBeta actin and LargeBiTExpressionMammalianPromoterEF1Available sinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterNative promoter from pMUT2 relB/relE operon and P…Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-α-chain
Plasmid#133730PurposeExpresses the gePSI-α-chain and ZsGreen1 under control of the inducible bi-directional TRE3G promoter.DepositorInsertsa-Chain_gePSI
ZsGreen1
ExpressionMammalianMutationOnly one part of the gePSI-system (aa1-141 + stop…PromoterpTRE3G-BiAvailable sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EGFR-L858R
Plasmid#116276PurposeLentiviral expression of EGFR L858RDepositorAvailable sinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CAG-mCherry
Plasmid#108685PurposeStrong CAG promoter with mCherry expression for transfection efficacy screeningDepositorInsertmCherry
ExpressionMammalianPromoterCAGAvailable sinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-Cas9-P2A-Puro
Plasmid#110837PurposeLentiviral vector for expression of Cas9 in mammalian cells (codon optimized)DepositorInsertCas9
UseLentiviralMutationWTPromoterEF1sAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FUS-FusionRed-PixD
Plasmid#111503PurposeFor PixELL systemDepositorAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRSET-4xTR-TUBE
Plasmid#110312PurposeE. coli expression and purification of 4xTR-TUBEDepositorInsert4xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available sinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTO_CHMP4B_LAP
Plasmid#101850PurposeTet-inducible expression of human CHMP4B with a C-terminal GFP and long linker (LAP tag), compatible with Flp-In recombination for stable integrationDepositorInsertCharged Multivesicular Body Protein 4B (CHMP4B Human)
UseGateway cloning, flp-frt recombination, tet-induc…TagsLocalization and Affinity Purification (LAP) tagExpressionBacterial and MammalianPromoterCMVAvailable sinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_PIK3CA_WT
Plasmid#81736PurposeGateway Donor vector containing PIK3CA , part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-TAF1
Plasmid#65395PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable sinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
AR-V7-pcw107
Plasmid#64635Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertAR (transcript variant 1, splice isoform) (AR Human)
UseLentiviralMutationsplice isoform*PromoterPGKAvailable sinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC475 - pAAV c-fos iRFP
Plasmid#47906PurposeAn AAV vector that expresses iRFP under the c-fos promoter.DepositorInsertInfrared fluorescent protein
UseAAVExpressionMammalianPromoterc-fosAvailable sinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-GFP-IMP2-2
Plasmid#42175DepositorInsertInsulin-like growth factor 2 mRNA binding protein 2-2 (IGF2BP2 Human)
TagsGFPExpressionMammalianPromoterT7Available sinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pD40-His/V5-c-MycT58A
Plasmid#45598DepositorAvailable sinceJune 10, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGEMTEZ-Kir2.1
Plasmid#32641DepositorPublicationInsertKir2.1 (Kcnj2 Mouse)
ExpressionBacterialAvailable sinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJA304
Plasmid#28091DepositorInsert(Gly)5Ala::mCherry(with introns)::tbb-2 3'UTR
ExpressionWormAvailable sinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only