We narrowed to 32,930 results for: Eng
-
Plasmid#104506PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSpGAL1 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4O
Plasmid#104510PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSpdGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4P
Plasmid#104511PurposeUsed to evaluate the expression output of Saccharomyces pastorianus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSptGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c
Plasmid#107599PurposeAn entry vector with U6a and U6c promoter driving guide RNAs expressionDepositorInsertsU6a promoter
U6c promoter
UseCRISPRAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK_BsmBI_LacZ_Cherry_Nanotag_117
Plasmid#130552PurposeEnhancer cloning nanotag reporter vectorDepositorInsertLacZ
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK_BsmBI_LacZ_Cerulean_Nanotag_89
Plasmid#130538PurposeEnhancer cloning nanotag reporter vectorDepositorInsertLacZ
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK_Citrine_Nanotag_32_neg_Control
Plasmid#130563PurposeEnhancer cloning nanotag reporter vectorDepositorInsertnegative oligo sequence
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTK_BsmBI_LacZ_Citrine_Nanotag_18
Plasmid#130519PurposeEnhancer cloning nanotag reporter vectorDepositorInsertLacZ
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTK_Cerulean_Nanotag_91_positive_Control
Plasmid#130572PurposeEnhancer cloning nanotag reporter vectorDepositorInsertFoxD3_cranial_neural_crest_enhancer_NC3
UseEnhancer cloning nanotag reporter vectorPromoterthymidine kinase minimal promoterAvailable SinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
EKAREN5-gl
Plasmid#225958PurposeThe YPet and mTurquoise sequence cassettes in EKAREN5(Addgene 167821) were replaced with a synonymous codon variant of YPet and mTurquoise-gl and subcloned into pCSII lentiviral backbone.DepositorInsertEKAREN5-gl
UseLentiviralTagsnls localization motifExpressionMammalianPromoterEF-1-alpha promoterAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMZ3012
Plasmid#204400PurposeA C4-HSL sensor for B. subtilis on a shuttle vector for B. subtilis and E. coli.DepositorInsertsUseSynthetic BiologyPromoterPftsH and Synthetic promoter PRhl0L0L12Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUltra-U6-gRNAs1-5
Plasmid#178569PurposeConstitutive expression of a gRNA-tRNA array for macsGESTALT editingDepositorInsert5 gRNA-tRNA array with U6 promoter
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_cAMPFIRE-L
Plasmid#182279PurposeMammalian expression of the cAMP sensor cAMPFIRE-L under a CMV promotor.DepositorInsertcAMPFIRE-L (cAMP sensor)
ExpressionMammalianAvailable SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCas9_D10A
Plasmid#41816PurposeExpresses human codon optimized Cas9 D10A mutant which functions as a nickase for genome engineeringDepositorInsertCas9_D10A
UseCRISPRExpressionMammalianMutationhuman codon-optimized, D10A nickasePromoterCMVAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
BPK2660
Plasmid#70709PurposeHuman expression plasmid for SaCas9 sgRNA(84nt in length) (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sa-sgRNA(84)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFW2000
Plasmid#224211PurposeE. coli-Bacteroides shuttle plasmid; pB8-51 (Bacteroides replication origin), p15A (E. coli replication origin)DepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-Dual-M2
Plasmid#135584PurposeHigh eukaryotic dual protein expression shuttle vectorDepositorTypeEmpty backboneUseTransfer vectorExpressionInsectPromoterpolyhedrin of AcMNPVAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pB025
Plasmid#183092PurposeExpresses FnCas12a in Bacteroides and used for genome editingDepositorInsertFnCas12a, gRNA, Promoter, HAB, TetR,
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1TDPGH023Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-RFP-miR-223
Plasmid#97148PurposemiR-223 expressionDepositorInsertmiR-223
UseZebrafishAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_mNG2(11)_Clathrin light chain
Plasmid#82608PurposeExpresses mNG2(11) tagged clathrin light chain in mammalian cellsDepositorInsertmNG2(11)_Clathrin light chain
ExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLS.492
Plasmid#184957PurposeTest effect of a1/a2 length on editing rpoB using retron recombineeringDepositorInsertEco1 RT and recombineering ncRNA, rpoB T1534C, a1/a2 length: 22
ExpressionBacterialMutationrpoB donor T1534C, a1/a2 length extended to 22 bpPromoterT7/lacAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9 (PX165)
Plasmid#48137PurposeHuman codon optimized Cas9 nuclease from Streptococcus pyogenes (Cbh-3X-FLAG-NLS-SpCas9-NLS)DepositorInserthSpCas9
UseCRISPRTags3XFLAGExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLX304-G3BP1-Lantern
Plasmid#250918PurposeExpresses Lantern fused to G3BP1 in mammalian cells for targeting to stress granulesDepositorInsertLantern
UseLentiviralTagsV5-G3BP1ExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT57
Plasmid#223429PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)
Plasmid#48139PurposeNOTE: A new version of this plasmid is now available. See Addgene plasmid 62988.DepositorInserthSpCas9-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT58
Plasmid#223430PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP hsp70
Plasmid#15215DepositorAvailable SinceJune 15, 2007AvailabilityAcademic Institutions and Nonprofits only