We narrowed to 59,739 results for: Gene
-
Plasmid#67943PurposeTransgenesis vector consisting of a 1.6-kb fragment of MyHC1 promoter region upstream of the start codon and an mCherry reporter gene, flanked by inverted binding sites of meganuclease I-SceIDepositorInsertmCherry
UseTransgenic reporter in the sea anemone, nematoste…PromoterMyosin Heavy Chain1 (MyHC1)Available SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v1
Plasmid#97081PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v1
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAEL010097-Cas9
Plasmid#100707PurposeThe promoter of AAEL010097 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL010097-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL010097 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf107
Plasmid#12795PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf107
ExpressionMammalianAvailable SinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pHJ12: CadC-VHH-Caffeine (No linker)
Plasmid#108244PurposeMembrane bound transcription activator CadC fusing VHH-Caffeine. Upon ligand binding, CadC-VHH-Caffeine can be dimerized and activate down stream reporter gene sfGFP expressionDepositorInsertMembrane bound transcription activator CadC fusing with VHH-Caffeine antibody without external linker
UseSynthetic BiologyPromoterpLacO1Available SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRBBm34
Plasmid#48114PurposeExpression of the gfp gene under control of the native xylose inducible promoter of Bacillus megateriumDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
Pveg
Plasmid#55173PurposeVery strong constitutive promoterDepositorInsertveg promoter
UseSynthetic Biology; Bacillus biobrick boxPromotervegAvailable SinceJuly 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2203
Plasmid#91066PurposeModule B, Promoter: CmYLCV, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_C2200), Terminator: none - to be fused to gRNA array in MODULE CDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterCmYLCVAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
LCC-ICCG_pET21b
Plasmid#215408PurposeExpression construct for LCC-ICCG gene, codon optimized for expression in E. coliDepositorInsertLCC-ICCG
ExpressionBacterialMutationF243I/D238C/S283C/Y127GAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn5-132
Plasmid#118518PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertsGFP2
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLAI-Env
Plasmid#133996PurposeEnv gene from HIV-1 LAI in pcDNA3.1 expression vectorDepositorInsertEnvelope Glycoprotein
ExpressionMammalianPromoterCMVAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
xlox dNGFR-TERT
Plasmid#69805PurposeMLV retroviral vector expressing the hTERT reverse transcriptase immortalizing gene and a tNGFR marker for trackingDepositorAvailable SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTHSSd_41
Plasmid#59964PurposeHigh full length T7 RNAP* expressionDepositorInsertT7* RNAP
ExpressionBacterialMutationN/APromoterPJ23105Available SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c5x_UnaG
Plasmid#163125PurposeA plasmid with UnaG coding sequence cloned into it. UnaG gene codon optimized for E. coli and B. theta. Expresses UnaG with N-term maltose-binding protein (MBP)-tag and C-term His-tag.DepositorInsertUnaG
TagsHis and MBPExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV9retro
Plasmid#224687PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap9retro
UseAAVMutationinsertion of 10-mer peptide from AAV2retro (LADQD…Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAIP
Plasmid#74171PurposeLentiviral vector for expression of heterologous genesDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterSFFVAvailable SinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGM190
Plasmid#69614Purposeinducible gene expression in StreptomycesDepositorInsertsaphII
tsr
rep
sso
TipA promoter
dso
UseStreptomyces- e. coli shuttle vectorExpressionBacterialAvailable SinceJan. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-MYC-t2A-BCL2
Plasmid#135306PurposeOverexpression of multiple human genes (BCL2 and MYC)DepositorAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BCL6-t2A-BCL2
Plasmid#135305PurposeOverexpression of multiple human genes (BCL2 and BCL6)DepositorAvailable SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-EF1a-BsdCas9-W
Plasmid#67978PurposeLentiviral vector expressing Cas9 fused with the Blasticidin resistant gene at the N-terminusDepositorInsertEF1a-Cas9 cassette, WPRE
UseCRISPR and LentiviralTagsCas9 fused with Flag-tag and a NLS at the N termi…PromoterEF1aAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiTet-LDLR-mCherry BlastR
Plasmid#186739PurposeDox inducible LDLR coding sequence expression construct cloned into a lentiviral backbone containing a blasticidin resistance geneDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Donor
Plasmid#159740PurposeContains EGFP flanked by a splice acceptor and a splice donor. Together with other intron tagging plasmids, it can be used to place the EGFP tag as a synthetic exon into introns of target genes.DepositorInsertEGFP
UseIntron tagging donorAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ultra-Exon1Q23-Myc-A
Plasmid#110486PurposeLentiviral vector to express wild-type N terminal HTT gene with short 3'UTR in mammalian cells (encodes Myc-tagged wild type huntingtin exon1 fragment with 23 repeats of Q)DepositorInsertHomo sapiens huntingtin (HTT Human)
UseLentiviralTagsMycExpressionMammalianMutationShort 3'UTR wild type huntingtin exon1 fragm…PromoterUbCAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3
Plasmid#108103PurposeLentiviral expression plasmid of human SIK3 cDNA with neomycin resistance geneDepositorAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
RAB11A-GFP HDRT Source (pTR 143)
Plasmid#112012PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with GFPDepositorInsertRAB11A-GFP HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-Fc-His
Plasmid#72165PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Plxna2-Fc-His
Plasmid#72123PurposeExpresses the extracellular region of the PlexinA2 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
TagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianPromoterCAGAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only