We narrowed to 10,145 results for: gnas
-
Plasmid#136435PurposeMammalian expression plasmid for c-myc-tagged PDGFRA (Y206S mutant)DepositorInsertPDGFRalpha (PDGFRA Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationY206S (disrupts PDGF binding, but still binds HCM…PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-bio-myc-mCE 2-210
Plasmid#112715PurposeExpresses N-terminally bio-myc-tagged mouse CE/Rngtt 2-210 in mammalian cellsDepositorInsertRngtt (Rngtt Mouse)
Tagsbiotinylation signal peptide (Tagwerker et al. 20…ExpressionMammalianMutationSilent mutation at Arg 132 (CGT to CGC), deleted …PromoterCMVAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
TLP-bio
Plasmid#47787PurposeExpresses enzymatically monobiotinylated full-length TLP ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised TLP
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
PF3D7_1431400-bio
Plasmid#47791PurposeExpresses enzymatically monobiotinylated full-length PF3D7_1431400 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised PF3D7_1431400
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Venus-TmiR-G12
Plasmid#25740PurposeLentiviral vector with Tet-based inducible expression of mouse G alpha 12 miR30-based shRNA, constitutive Venus fluorescent protein coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK ΔCRD-Fc
Plasmid#246706PurposeExpression vector for secreted human RECK lacking the CRD, fused to mouse IgG2a FcDepositorInsertRECK (RECK Human)
Tagsmouse IgG2a FcExpressionMammalianMutationΔaa 343-476, ΔGPI anchor signalPromoterCMVAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK ΔCK-Fc
Plasmid#246705PurposeExpression vector for secreted human RECK lacking CC domains 1-5, fused to mouse IgG2a FcDepositorInsertRECK (RECK Human)
Tagsmouse IgG2a FcExpressionMammalianMutationΔaa 37-338, ΔGPI anchor signalPromoterCMVAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK-Fc
Plasmid#246704PurposeExpression vector for a secreted human RECK-mouse IgG2a Fc fusion proteinDepositorInsertRECK (RECK Human)
Tagsmouse IgG2a FcExpressionMammalianMutationΔGPI anchor signalPromoterCMVAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK-His
Plasmid#246688PurposeExpression vector for secreted human RECK, C-terminal 6xHis tagDepositorAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HSE-CytoTape-V5
Plasmid#239426PurposeCytoTape signal monomer for recording HSE promoter transcriptional activityDepositorInsertCytoTape-V5 (HSPA1A Synthetic)
UseAAVTagsV5-dMBPExpressionMammalianPromoterHSPA1A promoterAvailable SinceOct. 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
L4219 TNFR2 CTEVp chain in PolyTX-mTagBFP2
Plasmid#244177PurposeConstitutive expression of a MESA CTEVp chain encoding (N to C): TNFR2SS-3xFLAG-TNFR2ECD-mCD28TMD-CTEVp(190K)-PRS(M)-VP64-ZF6DepositorInsertMESA CTEVp chain with human TNFR2 SS and ECD, murine CD28 TMD, CTEVp (190K), TEVp PRS (M in P1'), and synTF (VP64-ZF6) (TNFRSF1B Human, Synthetic)
UseSynthetic BiologyTagsTNFR2 signal peptide - 3xFLAGExpressionMammalianMutationCTEVp_190KPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(C8351G)-mascRNA](pAVA3000)
Plasmid#239349PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of C8351G MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA
ExpressionMammalianMutationMALAT1 ENE(C8351G)Available SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(C8351G)-mascRNA](pAVA2995)
Plasmid#239350PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of C8351G MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(C8351G)-mascRNA
ExpressionMammalianMutationMALAT1 ENE(C8351G)Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-TAILLESS
Plasmid#221117PurposeFAP tagged STE3-TAILLESS mutant (delta288-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-Tailless
ExpressionYeastMutationSTE3 mutant that lacks the entire C-terminal tail…PromoterSTE3Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_GLuc
Plasmid#226718PurposePlasmid enabling yeast-mediated expression and secretion of Gaussia luciferase (GLuc)DepositorInsertGaussia Luciferase
TagsHA tag and Mating factor alpha secretion signalExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
LTB4R-DuET
Plasmid#213333PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
TH1531-DuET
Plasmid#213243PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
GRM7-DuET
Plasmid#213305PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
HRH4-DuET
Plasmid#213315PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GRPR-DuET
Plasmid#213306PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
HCA2-DuET
Plasmid#213308PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR174-DuET
Plasmid#213271PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR160-DuET
Plasmid#213268PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPBA-DuET
Plasmid#213255PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FPR2-DuET
Plasmid#213240PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CYSLTR2-DuET
Plasmid#213226PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRB1-DuET
Plasmid#213180PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 43-372
Plasmid#205054PurposeTWNK protein expressionDepositorInsertTWNK (TWNK Human)
ExpressionBacterialMutationLacks Mitochondrial localization signal and C ter…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EFNB2 (D62Q)
Plasmid#200976PurposeMammalian expression plasmid for myc-tagged EFNB2 (D62Q specificity mutant)DepositorInsertEFNB2 (EFNB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationD62Q (increases specificity towards henipaviral G…PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-bio-myc-mCE 211-597
Plasmid#112716PurposeExpresses N-terminally bio-myc-tagged mouse CE/Rngtt 211-597 in mammalian cellsDepositorInsertRngtt (Rngtt Mouse)
Tagsbiotinylation signal peptide (Tagwerker et al. 20…ExpressionMammalianMutationdeleted amino acids 2-210 (triphosphatase domain)PromoterCMVAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-Nb127D01-mCherry-KDEL
Plasmid#171575PurposeExpresses mCherry-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-mCherry) in fly cell ER membraneDepositorInsertBiP-Nb127D01-mCherry-KDEL (CXCR2 Human)
TagsBiP signal peptide and mCherry-KDELExpressionInsectPromoterfly actin5C promoterAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-NbVHH05-mCherry-KDEL
Plasmid#171574PurposeExpresses mCherry-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-mCherry) in fly cell ER membraneDepositorInsertBiP-NbVHH05-mCherry-KDEL (UBE2J1 Human)
TagsBiP signal peptide and mCherry-KDELExpressionInsectPromoterfly actin5C promoterAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(E1418K/A1419R/S1421R/P1424Q/Y1426S)
Plasmid#155010PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 E1418K/A1419R/S1421R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationE1418K/A1419R/S1421/P1424Q/Y1426S; insert codes f…PromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-TOM20MTS-DDRGK1-dTM-HA
Plasmid#139861PurposeLentiviral expression of TOM20MTS-DDRGK1-dTM-HADepositorInsertTOM20-MTS-DDRGK1-dTM (DDRGK1 Human)
UseLentiviralTagsHAMutationrecombinant fusion of mitochondria-targeting sign…Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ArchT-tdTomato]
Plasmid#123607PurposeAAV mediated expression of ArchT-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. tdTomato has codons varied to reduce recombination. Using bGHpA signal.DepositorInsertArchT-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterSynAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Rescue myc-PCDHGC5 mRNA
Plasmid#122229PurposeRescue mRNA for Protocadherin gamma C5 knock down with sh1 shRNA (plasmid 122227). With five silent mutations at sh1 shRNA target site.DepositorInsertPCDHGC5 (Pcdhgc5 Rat)
Tags9E10 cMyc epitope (EQKLISEEDL) was inserted betwe…ExpressionMammalianMutationSilent mutations are in five consecutive codons …Available SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-ALFA-His
Plasmid#171568PurposeBacterial expression of ALFA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-ALFA-His)DepositorInsertNb127D01-ALFA-His (CXCR2 Human)
TagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn CaBLAM
Plasmid#244227PurposeBioluminescent reporter for calcium signaling in neuronsDepositorInsertsmNeonGreen
CaBLAM
UseAAVAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD9
Plasmid#247322PurposeThis plasmid can be used to quantify CD9 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-R-IscB-VR4-NLS (D60A, H243E, H269N, R270Q)_T2A_mCherry_U6-ωRNA
Plasmid#246431PurposeAll-in-one plasmid. Expresses R-IscB in mammalian cells. ssRNase enhancing mutations (H243E, H269N, R270Q) included.DepositorInsertsO.gue IscB-VR4 (H243E, H269N, R270Q) with RuvC dead mutations (D60A) and delta-TID
mCherry
ωRNA
TagsSV40 NLS, Thosea asigna virus 2A peptide, and nuc…ExpressionMammalianMutationchanged Aspartic Acid 60 to Alanine, changed Hist…PromoterCMV and U6Available SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
PB-NES-ZapCV2
Plasmid#222950PurposeGenetically-encoded Cytosolic Cyan-Yellow Zinc FRET sensor. Useful for detecting free zinc ion levels in the cytosol (in vitro Kd ~2.3 nM, n = 0.53)DepositorInsertNES-ZapCV2
TagsECFP (Enhanced Cyan Fluorescent Protein), Nuclear…ExpressionMammalianMutationECFP gene is truncated 36 bp at 3' end. Venu…Available SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pB–DualPE
Plasmid#235161PurposeFor plant prime editing including large DNA fragment editing in wheat plants or other monocotyledonsDepositorInsertsCsy4-P2A-Nls-nCas9-NC-nls-MLV-Nls
CmYLCV-epegRNA-CaMV poly(A) signal
UseCRISPRMutationDetailed in manuscriptAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only