We narrowed to 12,378 results for: shRNA
-
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-AasgRNA
Plasmid#121954PurposeMammalian expression, Genome editing, gRNA scaffoldDepositorInsertAaCas12b single chimeric gRNA
ExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSRP-mTAZ
Plasmid#31795DepositorInsertTAZ
UseRNAi and RetroviralPromoterRNA Pol-IIIAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Oct4-Cr1
Plasmid#66989PurposeExpresses gRNA that targets stop codon for OCT4DepositorInsertgRNA for Crispr targeting the OCT4 stop codon
ExpressionMammalianAvailable SinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pgRNAtet-phaZ
Plasmid#169874PurposeSingle guide RNA plasmid for Cas9 targeting phaZ in P. putidaDepositorInsertsgRNA towards phaZ in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_GAL4UAS-Luciferase reporter
Plasmid#64159PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA3 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA3 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[Spinach2]
Plasmid#68430PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "Spinach2" aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct_bearing the "Spinach2" aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pV1435
Plasmid#111439PurposeSolo vector pV1382 + sgCgADE2DepositorInsertCaCas9/sgCgADE2
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
hADAM10 siRNA pSIREN-Retro-Q
Plasmid#19140DepositorInsertADAM10 siRNA
UseRNAi and RetroviralExpressionMammalianAvailable SinceSept. 8, 2008AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
Plasmid#172225PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV/3' Box_(GLuc)_TOP2
Plasmid#68435PurposeTransient expression of the "TOP2" construct, targeting the GLuc reporter, in mammalian cells. CMV/3' Box expression backbone.DepositorInsertTOP2 construct
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_1
Plasmid#73525PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
T5-sgRNA
Plasmid#113655PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter T5 and sgRNA
UseCRISPRExpressionBacterialPromoterT5Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG_GI4
Plasmid#111595PurposeGI Library VectorDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330 RAD21 gRNA
Plasmid#165592PurposeInsertion of RAD21 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 2
Plasmid#70657PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only