We narrowed to 15,106 results for: EGF;
-
Plasmid#109014PurposeTet-On construct to induce expression of tandem eGFP-mCherry tagged RAMP4 (ER marker)DepositorInsertRAMP4 (SERP1 Human)
UseLentiviralTagsmCherry-eGFPExpressionMammalianPromoterCMV promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCL/IFNB1-d2eGFP-3’UTR
Plasmid#180232PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1DepositorInsertd2eGFP
UseLentiviralPromoter1 kb upstream of IFNB1 CDSAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXR001: EF1a-CasRx-2A-EGFP
Plasmid#109049PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targetingDepositorInsertCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianPromoterEF1AAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28 His6-mEGFP-D4H
Plasmid#226373PurposeProduction of recombinant mEGFP-D4H, a fluorescent probe binding cholesterolDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_miniSOG2 T2A H2B-EGFP
Plasmid#87410PurposeMammalian expression vector encoding Histone 2B GFP fusion and miniSOG2DepositorInsertmini singlet oxygen generator 2
ExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CBh-DIO-EGFP
Plasmid#87168PurposeExpression of eGFP in the presence of CreDepositorInsertEGFP
UseAAVTagsNoneAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-EGFP-NLS-3XFLAG-V5
Plasmid#196090PurposeExpresses gfp in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertGFP
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianPromoterCAGGsAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTU2-AmyE-Pveg-eGFP
Plasmid#112792PurposeExpresses GFP under the control of Pveg promoter and it is integrated into AmyE locus. Used to test correct transformationDepositorArticleInsertPveg-eGFP
ExpressionBacterialAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3XHA-EGFP-PEX26
Plasmid#139054PurposeHA-PEROXO Lentiviral Construct. Expresses a Peroxisomal Tag.DepositorInsert3XHA-EGFP-PEX26
UseLentiviralTagsHAPromoterUBCAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mEGFP
Plasmid#175293PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mEGFP
TagsmEGFPExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-117:POLR2A-mEGFP
Plasmid#164500PurposeHomology arms and mEGFP-linker sequence sequence for N-terminus tagging of human POLR2ADepositorInsertPOLR2A Homology Arms with mEGFP-linker (POLR2A Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceFeb. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB-TRE-EGFP-EF1a-rtTA
Plasmid#104454PurposePiggyBac plasmid expressing EGFP under the control of a doxycycline-inducible promotorDepositorInsertsenhanced green fluorescent protein
reverse tetracycline-controlled transactivator 3
UsePiggybacExpressionMammalianAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXR002: EF1a-dCasRx-2A-EGFP
Plasmid#109050PurposeCatalytically inactive dCasRx with 2A-EGFPDepositorInsertdCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianMutationR239A/H244A/R858A/H863AAvailable SinceApril 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau P301L
Plasmid#46908Purposeexpresses EGFP tagged Tau P301L in mammalian cellsDepositorAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
CHIKV eGFP-Zeo replicon
Plasmid#249289PurposeSP6-driven CHIKV_LR2006 OPY1 replicon with eGFP-Zeocin reporter selection cassetteDepositorInsertCHIKV LR2006-OPY1 replicon harboring nonstructural genes (nsp1-nsp4) and eGFP-Zeocin ORF in place of structural genes
ExpressionBacterialMutationstructural polyprotein open reading frame deleted…PromoterSP6Available SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Puro-P2A-EGFP
Plasmid#137729PurposeFor simple determination of the multiplicity of infection (MOI) of a lentiviral CRISPR library by checking EGFP expression (still allowing for puro selection).DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsEGFPExpressionBacterial and MammalianAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT_mEGFP-SNAP-tag2
Plasmid#226513PurposeMamalian cell expression of cytosolic mEGFP-SNAP-tag2DepositorInsertmEGFP-SNAP-tag2
ExpressionMammalianAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19 - T7 pro - IRES - EGFP
Plasmid#138586PurposeExpress EGFP with an upstream T7 promoter in pUC19 backboneDepositorInsertEGFP
Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only