We narrowed to 24,925 results for: crispr
-
Plasmid#187960PurposeAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-GGAC-ATGC
Plasmid#60949PurposeDrosophila, backbone for donor plasmid assembly. CRISPR knock-in.DepositorTypeEmpty backboneUseCRISPRAvailable sinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSC101-Donor
Plasmid#140630PurposeKanamycin resistance donor for ShCAST_harboring the temperature sensitive pSC101 origin of replication.DepositorInsertLE, RE, KanR, temperature sensitive pSC101 origin of replication
UseCRISPR; TransposonExpressionBacterialAvailable sinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9-VRER_2A_GFP
Plasmid#75475PurposeCas9 VRER variant that detects NGCG PAM, combined with 2A_GFP for expression controlDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-VRER
UseCRISPRTags2A_GFPExpressionMammalianMutationD1135V, G1218R, R1335E, T1337RPromoterCAGAvailable sinceMay 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHMGWA-Pa14Csy4H29A
Plasmid#41092DepositorInsertCsy4
TagsHis6-MBPMutationHis29Ala mmutation to abolish ribonuclease activi…PromoterT7Available sinceDec. 3, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BB3cK_pGAP_23*_pTEF_Cas9
Plasmid#104909PurposehCas9 under control of Tef1 for direct cloning of HH-sgRNA-HDV PCR products and episomal expression in P. pastoris and G418 selectionDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
U6-BbsI-DR_CMV-minidCas13X.1-REPAIRv2-BGHpA_CMV-EGFP-BGHpA
Plasmid#171383PurposeExpression vector for encoding a human codon-optimized minidCas13X.1-REPAIRv2 driven by CMV promoter,EGFP driven by CMV promoter and U6-driven crRNAs cloning site.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized minidCas13X.1-REPAIRv2
TagsHAExpressionMammalianPromoterCMV, U6Available sinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal.Sth.dCas9
Plasmid#171088PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
DHFR-TSc3
UseToxoplasma gondii expressionMutationNote: A S245F mutation is present but did not app…PromoterDHFR-TS (Toxoplasma gondii) and U6 (Toxoplasma go…Available sinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
M3-M14-dCas9
Plasmid#134779PurposeExpression of fusion protein M3-M14-dCas9 in Mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertExpressionMammalianPromoterCMVAvailable sinceFeb. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting Ctnnb1 (Ctnnb1 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-dTAG-Puro
Plasmid#207727PurposeEmpty C-terminus donor cassette. Integrate homology arms to target the C-terminus insertion of a dTAG-2A-Puro cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330-AAVS1
Plasmid#227272PurposeExpresses SpCas9 and a sgRNA targeting the AAVS1 loci for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting AAVS1 (AAVS1 Synthetic)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pC0041-RanCas13b crRNA backbone
Plasmid#103852PurposeFor cloning of guide RNAs compatible with RanCas13b. Contains a 3' direct repeat. Clone using BbsI (BpiI). F overhang cacc. R overhang caac.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertU6-RanCas13b DR-BbsI-BbsI-polyT
UseCRISPRExpressionMammalianAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC588
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available sinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMTL5
Plasmid#127967PurposeDHFR-degron controlled expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1-CAG-DHFR-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable sinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJK429
Plasmid#155376PurposePphlF_A4NT in dCRv1, 1x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A4NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available sinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA with U6 promoter
Plasmid#48962Purposeto drive the sgRNA expression under a U6 promoterDepositorPublicationTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available sinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by