We narrowed to 12,043 results for: shRNA
-
Plasmid#124622PurposeExpresses adRNA(2,100,50) targeting the RAB7A transcript along with GFPDepositorInsertGluR2_adRNA(2,100,50)
UseAAVExpressionMammalianPromoterU6Available SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
GluR2_adRNA(0,100,50)-GFP
Plasmid#124623PurposeExpresses adRNA(0,100,50) targeting the RAB7A transcript along with GFPDepositorInsertGluR2_adRNA(0,100,50)
UseAAVExpressionMammalianPromoterU6Available SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGE7
Plasmid#79462PurposesgRNA shuttle vector; module 2DepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE9
Plasmid#79465PurposesgRNA shuttle vector; module 3DepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE11
Plasmid#79467PurposesgRNA shuttle vector; module 4EDepositorInsertpAtU6-ccdB-sgRNA (ccdB(letD) )
UseCRISPR and Synthetic BiologyMutationBsaI site eliminatedAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBM23-pyrF-NT
Plasmid#174384PurposepBM23 contained pyrF and mini-CRISPR.DepositorInsertpyrF-NT
UseTemplate for cloning fragments for chromosomal in…ExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBM23-pyrF-CS
Plasmid#174396PurposepBM23 contained pyrF and mini-CRISPR.DepositorInsertpyrF-CS
UseTemplate for cloning fragments for chromosomal in…ExpressionBacterialAvailable SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG3K-U6EC1
Plasmid#134757PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3B-U6EC1
Plasmid#134756PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-EC1Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG3H-U3Ub
Plasmid#134749PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA- OsU3, zCas9-Ubi1Available SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD3_2
Plasmid#86338PurposeEncodes gRNA for 3' target of human TEAD3DepositorInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD3_1
Plasmid#86337PurposeEncodes gRNA for 3' target of human TEAD3DepositorInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh3
Plasmid#163743PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTX1-EV71-SL2
Plasmid#126043PurposeIn-vitro-transcription of Enterovirus 71 5UTR-SL2 RNA in NMR tube for "Systems NMR" analysisDepositorInsertEnterovirus 71 5'UTR SL2
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh1
Plasmid#163741PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO-neo CXCR4-sh2
Plasmid#163742PurposeLentivirus for inducible knockdown of CXCR4 (human)DepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ad-shMKP-3
Plasmid#131530PurposeSilence the MKP-3 expressionDepositorInsertShort hairpin mitogen-activated protein kinase phosphatase 3 (Dusp6 Mouse)
UseAdenoviralTagsNoAvailable SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-sgMDH1
Plasmid#72875PurposeThe lentiviral sgMDH1 vectors was generated via ligation of hybridized oligos (below) into lentiCRISPR-v1 vector linearized with BsmBI using Gibson assembly (NEBDepositorInsertsgMDH1
UseLentiviralAvailable SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pADH118-2
Plasmid#90984PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.alb LEUpOUT CRISPR system. Use with pADH137 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. albicans LEU2 2 of 2
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only