We narrowed to 11,071 results for: AGA
-
Plasmid#215934PurposeFragmid fragment: (guide cassette) reverse orientation; guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0 [EnAs]; sgCD4_v1 [EnAs]; DR_v1 [EnAs]; sgCD4_v2 [EnAs]}
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGMC00036 (aka pMC0223)
Plasmid#212659PurposeGuide RNA targeting SERPINB3DepositorAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TAL1(11))-PGKpuro2ABFP-W
Plasmid#208545PurposeLentiviral vector expressing gRNA targeting human TAL1DepositorInsertTAL1(11) (TAL1 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(MRPS26(15))-PGKpuro2ABFP-W
Plasmid#200499PurposeLentiviral vector expressing gRNA targeting human MRPS26DepositorInsertMRPS26(15) (MRPS26 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
INS-3'gRNA
Plasmid#210468PurposegRNA targeting INS 3' terminal for CRISPR-Cas9-mediated knock-inDepositorInsertINS (INS Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-shTAL1
Plasmid#210640PurposeKnockdown of TAL1 endogenous (3'UTR)DepositorInsertTAL1 3' UTR gRNA (TAL1 Human)
UseLentiviralAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L2_sgRNA1
Plasmid#201602PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L2 (LUC7L2 Human)
UseCRISPR and LentiviralAvailable SinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCINeo-gp78 Mutant G2BR
Plasmid#185355PurposeAssessing cellular requirement for G2BRgp78DepositorAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA3
Plasmid#204528PurposeLentiviral expression of MPL-shRNA3; gene knock down of human MPLDepositorInsertMPL-shRNA3 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ACIN1_sgRNA2
Plasmid#201589PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertACIN1 (ACIN1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-LUC7L2_sgRNA2
Plasmid#201603PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertLUC7L2 (LUC7L2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#1/Cre
Plasmid#193221PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Flnc
Plasmid#174870PurposeCRISPR vector for generating Flnc STREAMING-tag KI cellDepositorInsertsgRNA for mouse Flnc (Flnc Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-6
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-2
Plasmid#193665PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#1/Cre
Plasmid#193242PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#1/Cre
Plasmid#193248PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSphkap#2/Cre
Plasmid#193241PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sphkap geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#2/Cre
Plasmid#193238PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#1/Cre
Plasmid#193237PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#2/Cre
Plasmid#193247PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#2/Cre
Plasmid#193228PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#2/Cre
Plasmid#193230PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRos1#1/Cre
Plasmid#193233PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRos1#2/Cre
Plasmid#193234PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#1/Cre
Plasmid#193235PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch1#2/Cre
Plasmid#193224PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#2/Cre
Plasmid#193222PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#1/Cre
Plasmid#193227PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#1/Cre
Plasmid#173613PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmad4#2/Cre
Plasmid#173618PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smad4 (Smad4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#2/Cre
Plasmid#173644PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgStag2#2/Cre
Plasmid#173660PurposeExpresses a Stag2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Stag2 (Stag2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
330-cherry-hCYP3A4-enhancer-L-sgRNA
Plasmid#176840PurposeTargeting human CYP3A4 proximal enhancer left boundary. sgRNA expressing cells could be FACS sorted by cherry expression.DepositorInsertHuman CYP3A4 proximal enhancer left boundary
ExpressionMammalianPromoterU6Available SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_KLF4
Plasmid#140104PurposeCRISPR-Cas9 library validationDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralPromotergRNA1 under U6 and gRNA2 under H1Available SinceApril 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone2
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
BE3-YE1
Plasmid#132943PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-(W90Y-R126E)
UseCRISPR; Base editorExpressionMammalianMutationBE3-(W90Y-R126E)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g3 (BB24)
Plasmid#139459PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgSIK3-D
Plasmid#138675PurposeExpresses a mouse SIK3-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-2/3-3'
Plasmid#117325PurposeCRISPR-Cas9 for miR-124-2/3, 3'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
pPN207
Plasmid#91658PurposeExpress sgRNA targeting human REREDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN102
Plasmid#91629PurposeExpress sgRNA targeting human IMMP2LDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only