We narrowed to 27,024 results for: CAT;
-
Plasmid#53591PurposeNano-lantern-based luminescent cAMP indicatorDepositorInsertNano-lantern-based luminescent cAMP indicator
Tags6xHisExpressionBacterialAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Hook3 aa 1-552
Plasmid#74614PurposeExpresses a truncation of Hook3 in bacteria for purificationDepositorInserthuman Hook3 amino acids 1-552 (HOOK3 Human)
Tags6x His, Strep II, and superfolder GFPExpressionBacterialAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSEVA221rAPOBEC1-T7RNAP
Plasmid#167979PurposeExpresses fusion protein rAPOBEC1-T7RNAP in E. coliDepositorInsertrAPOBEC1-T7RNAP (T7p07 Synthetic)
TagsT7 tag and T7RNAPExpressionBacterialPromoterTetR-PtetAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF6 VPS52-V5-6His
Plasmid#175096PurposeV5 tagged VPS52 is expressed in mammalian cellsDepositorInsertVPS52 (VPS52 Human)
TagsV5ExpressionMammalianMutationN666D- please see depositor commentAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-C2gamma
Plasmid#21215DepositorInsertGFP-pcDNA3-PKCgamma-c2 (Prkcg Rat)
TagsGFPExpressionMammalianMutationThe C2-domain from PKCgamma (aa170-260) plus flan…Available SinceJuly 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
groSL-GFP
Plasmid#109389PurposeGFP cassette under the control of the groSL sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertpgroSL-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4137382
Plasmid#149539PurposeMammalian expression plasmid for SARS-CoV-2 surface glycoprotein (Spike) for VSV pseudotypingDepositorInsertSARS-CoV-2 S (surface glycoprotein) (S Severe acute respiratory syndrome coronavirus 2, Human)
ExpressionMammalianMutationH. sapiens recode;19-aa CtruncPromoterCMVAvailable SinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046852
Plasmid#145584PurposeBacterial Expression plasmid for SARS-CoV-2 nsp8DepositorInsertSARS-CoV-2 nsp8 (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHISExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 28, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
nls-Flamindo2
Plasmid#73939PurposeExpresses biosensor for cAMP in mammalian cells with nuclear localization signalDepositorInsertnls-Flamindo2
ExpressionMammalianPromoterCMVAvailable SinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA EYFP
Plasmid#167906PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDonor14-ShoHELIX-KanR (BO4)
Plasmid#181795PurposepDonor for ShoHELIX containing 14bp of spacing between the I-AniI site and LE/RE using ShCAST flanking sequence and encoding a kanamycin resistance gene as cargoDepositorInsertKanR, R6K origin of replication
ExpressionBacterialAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DD-T6B-WT-YFP
Plasmid#235143PurposeExpresses the inducible T6B peptide fused with DHFR and YFP under the human synapsin promoterDepositorInsertDHFR-fused T6B peptide
UseAAVPromoterhSynAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLAG-HA-T6B-WT-YFP
Plasmid#235139PurposeExpresses the T6B peptide fused with YFP under the human synapsin promoterDepositorInsertT6B peptide
UseAAVTagsFLAG/HAPromoterhSynAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRSin_hTCRβεζ
Plasmid#187353PurposeLentiviral expression of GPa3b17 hTCR beta, and truncated hCD3 (epsilon, and zeta)DepositorInsertGPa3b17 hTCR beta, and truncated hCD3 (epsilon, and zeta)
UseLentiviralPromoterSFFVAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-N-Flag-8His
Plasmid#157677PurposeN-terminal tagging vectorDepositorInsertFlag-8His
ExpressionMammalianAvailable SinceAug. 4, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTS93 pHAGE2 CMVtetO2 GFP-22xGS-MCS
Plasmid#199346PurposeLentiviral transfer plasmid for doxycycline inducible expression of a N-terminally GFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4137383
Plasmid#149541PurposeMammalian expression plasmid for SARS-CoV-2 surface glycoprotein (Spike) for VSV pseudotypingDepositorInsertSARS-CoV-2 S (surface glycoprotein) (S Severe acute respiratory syndrome coronavirus 2, Human)
ExpressionMammalianMutationH. sapiens recode;18-aa CtruncPromoterCMVAvailable SinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
mEmerald-MCM4-C-19
Plasmid#54167PurposeLocalization: Nucleus, Excitation: 487, Emission: 509DepositorInsertMCM4
TagsmEmeraldExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
RIP-Timer (DM#285)
Plasmid#15109DepositorInsertinsulin II promoter (Ins2 Rat)
ExpressionMammalianAvailable SinceOct. 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAC-GGPPipi
Plasmid#53280PurposeContains crtE and idi genes of Erwinia herbicola (Pantoea agglomerans) Eho10, and thereby produces geranylgeranyl diphosphate in E. coliDepositorInsertcrtE, idi
UseLow copy number bacterial cloning vectorPromoterendogenous promotersAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pH6HTC_HSPA5-Halo
Plasmid#175326PurposeProduction of HaloTag fusion proteinDepositorAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_miRFP703
Plasmid#134985PurposeThe plasmid includes a miRFP703 gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertmiRFP703
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMUT2-VtrA-mCherry
Plasmid#192862PurposepMUT2 based vector for sensing human secondary bile acids in E. coli Nissle 1917DepositorInsertVtrA-CadC fusion protein and cognate promoter inducible by secondary bile acids
ExpressionBacterialAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
LbdCas12a KRAB
Plasmid#188503PurposeExpresses FLAG tagged LbdCas12a KRABDepositorInsertdCas12a
UseCRISPR and LentiviralExpressionMammalianMutationD832APromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
enz.083-NMT1
Plasmid#154047PurposeExpresses NMT1 in E. coliDepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;cldn5bP1Egfp
Plasmid#90158Purposecontains cldn5b specific gene promoter driving expression of eGFPDepositorAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
ibpAB-GFP
Plasmid#109390PurposeGFP cassette under the control of the ibpAB sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertpibpAB-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRAIP-SFB
Plasmid#101769PurposeMammalian expression of TRAIP fusion proteinDepositorInsertTRAIP / RNF206 (TRAIP Human)
TagsS peptide-flag-streptavidin binding peptide (SFB)ExpressionMammalianMutationsiRNA-resistant alleleAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Bax1-2/L-6
Plasmid#30533DepositorInsertBCL2-associated X protein (BAX Human)
TagseGFPExpressionMammalianMutationF30C E44C C62S L63C C126S P130CAvailable SinceJuly 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-scrCdh20.1 GFP
Plasmid#209106PurposeGFP expressing scramble of shRNA targeting Cdh20DepositorInsertscrCdh20.1
Available SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
htpG1-GFP
Plasmid#109387PurposeGFP cassette under the control of the htpG1 sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertphtpG1-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-mt-ro1GFP
Plasmid#82407PurposeExpression of redox sensitive GFP with a mitochondrial targeting sequence in mammalian cellsDepositorInsertro1GFP
Tagsleader sequence of the E1α subunit of pyruvate de…ExpressionMammalianMutationC48S/F64L/T65S/S147C/Q204CPromoterCMVAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4046979
Plasmid#145611PurposeBacterial Expression plasmid for SARS-CoV-2 nsp7DepositorInsertSARS-CoV-2 nsp7 (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHISExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 28, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
35S-DsREDmonomer-NosT
Plasmid#79183PurposeTransient expression vector for DsRED monomerDepositorTypeEmpty backboneUseReporter plasmidTagsDsREDmonomerExpressionPlantPromoterCaMV35SAvailable SinceAug. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLNC Wnt-3aHA
Plasmid#18030DepositorAvailable SinceJuly 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pET28a-UBC9-K14R-A129K
Plasmid#228948Purposeexpress a fragment of the double mutant of the human UBC9 (generated from pET28-UBC9 through mutagenesis; point mutations: K14R and A129K)DepositorInsertUBC9 (UBE2I Human)
TagsHis tag and thrombine cleavage site : MGHHHHHHSSG…ExpressionBacterialMutationchanged Lysine 14 to Arginine, changed Alanine 12…PromoterT7-lacAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMKIIa-C1C2-EYFP
Plasmid#35519DepositorInsertChR1-ChR2 Chimera
UseLentiviralTagsEYFPExpressionMammalianPromoterCaMKIIaAvailable SinceJune 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-Tax(M47)
Plasmid#23286DepositorInsertTax(M47)
ExpressionMammalianMutationL319R L320SAvailable SinceApril 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pH6HTC_RBFOX2-Halo
Plasmid#175304PurposeProduction of HaloTag fusion proteinDepositorAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only