We narrowed to 9,579 results for: Pol
-
Plasmid#212711PurposeBacterial expression of His6-UBCH7DepositorInsertUBCH7
Tags6xHisExpressionBacterialAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCk3_spacer
Plasmid#136073PurposeUse when making even level constructs (L2,...) if pCk3 position (position 3) has no construct assignedDepositorInsertOdd spacer
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
p3xFlag-Dam
Plasmid#121909PurposeExpresses E. coli Dam methyltransferase containing an N-ternimal 3xFlag tagDepositorAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCsA
Plasmid#136067PurposeAcceptor plasmid for even level position 1, lacZ blue-white screeningDepositorInsertlacZ
UseSynthetic BiologyExpressionPlantAvailable SinceNov. 30, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pmCherry-N1_SEPT2
Plasmid#71549Purposemammalian expression of Sept2 with an mCherry fusion.DepositorAvailable SinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDOXOFF 99xGly
Plasmid#211346PurposeDOX-regulated lentiviral expression of 99xGly-EGFP-3xHADepositorInsert99xGly-EGFP-3xHA
UseLentiviralTagsEGFP-3xHAAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SnoopCatcher
Plasmid#72322PurposeBacterial expression of SnoopCatcher, an engineered protein forming a spontaneous covalent bond with its cognate peptide partner SnoopTag.DepositorInsertpET28a-SnoopCatcher
TagsHis6 tagExpressionBacterialMutationchanged G842T and D848G of S. pneumoniae adhesin …PromoterT7Available SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDOXOFF 15xGly
Plasmid#211345PurposeDOX-regulated lentiviral expression of 15xGly-EGFP-3xHADepositorInsert15xGly-EGFP-3xHA
UseLentiviralTagsEGFP-3xHAAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-MBP
Plasmid#72323PurposeBacterial expression of Maltose Binding Protein linked to SnoopTag, a peptide tag forming a spontaneous covalent bond with its protein partner Snoopcatcher.DepositorInsertpET28a SnoopTag-MBP
TagsN-terminal His6 tag. MBP is fused at the C-termin…ExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
HDM_RSV_Long_G_31AACTdel
Plasmid#237350PurposeExpression plasmid for RSV Long GDepositorInsertRSV Long G from Genbank Accesion AY911262.1
ExpressionMammalianMutation31 amino acid cytoplasmic tail deletionPromoterCMVAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
HDM_RSV_Long_F
Plasmid#237349PurposeExpression plasmid for RSV Long FDepositorInsertRSV Long F from Genbank Accesion AY911262.1
ExpressionMammalianPromoterCMVAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA2
Plasmid#73982PurposeOtx2 shRNA2 (based on mir155) was inserted into the 3'UTR of EGFP.DepositorInsertEGFP-Otx2-shRNA2
UseRNAiExpressionMammalianPromoterCAGAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag Runx1 FL (P#1790)
Plasmid#14585DepositorAvailable SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
TEV Protease-mCherry
Plasmid#243793PurposeEncodes for mammalian expression of TEV protease input. Construct contains a mCherry to indicate successful transfection and full plasmid read-through. Each protein is separated by a P2A self-cleaving sequence.DepositorInsertTEV protease
ExpressionMammalianAvailable SinceOct. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-UBF
Plasmid#17656DepositorAvailable SinceApril 28, 2008AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Acsm2
Plasmid#48158Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of Acsm2 (Acsm2 Mouse)
UseLuciferaseAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
YFN43
Plasmid#89487PurposeGateway-based Bimolecular Fluorescence Complementation (BiFC) binary vector containing N terminal fragment of YFPDepositorTypeEmpty backboneTagsYFP-N (aa 1-154)ExpressionPlantPromoter2x35SAvailable SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only