We narrowed to 10,763 results for: ESP
-
Plasmid#163337PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the mPGK promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromotermPGKAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD3-P2A-CD90.2
Plasmid#163335PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the hFTH1 promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromoterhFTH1Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1-R249E-R289E-R296E
Plasmid#159532PurposeExpresses Arabidopsis thaliana VERNALIZATION1 mutant, with R249E, R289E and R296E mutations, in E. coliDepositorInsertVERNALIZATION1 (VRN1 Mustard Weed)
TagsSix-Histidine tagExpressionBacterialMutationThree charge reversal mutations, namely R249E R28…PromoterT5Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-ELP-ddFLN4-XMod-Doc-HIS (BMB-KO)
Plasmid#153441PurposeE. coli expression of Rc. XDocB binding mode B knock-out construct containing ybbr tag, ELP linker and ddFLN4 fingerprint domain. This construct was designed for AFM measurements.DepositorInsertRc. XDocB binding mode B knock-out mutant
Tags3xELP linker, 6xHis, ddFLN4 fingerprint domain, a…ExpressionBacterialMutationArginine 140 and methionine 144 were mutated to a…PromoterT7 promoterAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3
Plasmid#124435PurposeChimeric ETS domain: H3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis TagExpressionBacterialMutationResidues 225 to 239 replaced with corresponding s…Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Loop
Plasmid#124551PurposeChimeric ETS domain: Loop of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 216 to 223 replaced with corresponding s…Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-S3
Plasmid#124550PurposeChimeric ETS domain: S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 242 to 246 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PU.1-ETS-H2
Plasmid#123358PurposeChimeric ETS domain: H2 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 207 to 215 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 blast OFF 3xflag IREB2
Plasmid#169889PurposeExpress 3x flag IREB2, suppressible by doxycycline additionDepositorInsertIREB2 (IREB2 Human)
UseLentiviral; Doxycycline mediated suppressionTags3x FlagExpressionMammalianMutationSilent mutations in sgIREB2_1 and sgIREB2_2 targe…PromoterTREAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
TERT - R865C
Plasmid#213926PurposeExpresses Mutant TERT R865CDepositorInsertMutant TERT R865C (TERT Human)
UseLentiviralTags6x His TagExpressionMammalianMutationArginine 865 changed to CysteinePromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-EGR1
Plasmid#52724Purposeretroviral expression of human EGR1DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_epegRNA_entry-mpknot_(LM1140)
Plasmid#228253PurposepU6 entry plamid for cloning prime editor mpknot epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertmpknot entry plasmid backbone for epegRNA expression via human U6 promoter
ExpressionMammalianMutationn/aPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD9
Plasmid#247322PurposeThis plasmid can be used to quantify CD9 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTubb3-MC
Plasmid#87112Purposeminicircle parental backbone plasmid including GFP knock-in donor targeting Tubb3 gene and one cutting site for HITIDepositorInsertGFP
UseCRISPRAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hHelios-IRES-GFP
Plasmid#74047Purposeretroviral plasmid for expression of FLAG-tagged human Helios (IKZF2) corresponding to cDNA from NM_001079526.1DepositorInserthuman Helios (IKZF2) (IKZF2 )
UseRetroviralTagsFLAGExpressionMammalianMutationencodes shorter version of human HeliosPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-endo-GsCT
Plasmid#205516PurposeEndosome-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertendo-GsCT (GNAS Synthetic, Human)
Tags2xFYVE (Fab1/YOTB/Vac1/EEA1 zinc-finger) and mChe…ExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN113 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-NeoR-bpA-Frt-Rosa26
Plasmid#86233PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Neomycine selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC-VIOL
Plasmid#53087PurposeProduces the carotenoid violaxanthin in E. coli.DepositorInsertzep (ABA1 Mustard Weed)
UseLow copy number bacterial cloning vectorMutationLacks codons for the first 60 N-terminal amino ac…PromoterT7Available SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hIKAROS-IRES-GFP
Plasmid#74046Purposeretroviral plasmid for expression of FLAG-tagged human Ikaros corresponding to cDNA from XM_011515058.1DepositorInserthuman Ikaros (IKZF1) (IKZF1 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAi14-GFPNLS-MC
Plasmid#87114Purposeminicircle parental backbone plasmid including GFPNLS-pA knock-in donor and one cutting site for HITIDepositorInsertGFPNLSPpA
UseCRISPRPromoternEFAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-nuc-GsCT
Plasmid#205517PurposeNuclear-targeted C-terminal fragment of human Gαs protein (Gαs inhibitory peptide).DepositorInsertnuc-GsCT (GNAS Synthetic, Human)
TagsHistone H2A and mCherryExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN395 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE targeting
Plasmid#92141PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-YFP
Plasmid#55781PurposeThis G protein alpha-s construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-s-EE YFP (Gnas Rat)
TagsEYFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationMet was substituted for Gln69 in EYFP (Clontech).…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMH002_phiC31_neo-5xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179430PurposeDual fluorescent reporter construct with single HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-HS4-mch (SH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAi14-luc-MC
Plasmid#87113Purposeminicircle parental backbone plasmid including luc-pA knock-in donor and one cutting site for HITIDepositorInsertLuciferase-SV40pA
UseCRISPR and LuciferaseAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-[BsmBI_pegRNA_entry]-tevopreQ1-term (LM1138)
Plasmid#223137PurposepU6 entry plamid for cloning prime editor tevopreQ1 epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertetevopreQ1 entry plasmid backbone for epegRNA expression via human U6 promoter
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMH014_AAVS1_puro-pA-HS4-9xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179436PurposeDual fluorescent reporter construct with double HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertHS4-TRE-cit-HS4-mch (DH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pICE-HA-Ku70-siR-Mut6E
Plasmid#82330PurposePlasmid for constitutive or doxy-inducible expression of mutant human Ku70 unable to bind DNA and resistant to siRNA. Confers resistance to puro. Use T-REx cells for doxycycline-inducible expression.DepositorInsertKu70 (XRCC6 Human)
TagsHAExpressionMammalianMutationMut6E corresponding to K282E K287E T300E K331E K3…PromoterCMV-tetAvailable SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianPromoterEF1aAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF-His-mTET1CD∆cat
Plasmid#81054Purposebacterial expression of catalytic dead catalytic domain of murine TET1DepositorInsertTET1 (Tet1 Mouse)
Tags6HISExpressionBacterialMutationcatalytic domain amino acid 1367-2057 with histid…PromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
GNAS_pcDNA6.2/EmGFP-Bsd
Plasmid#176976PurposeMammalian expression vector encoding GNAS and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5)
Plasmid#55799PurposeThis G protein alpha-s mutant exhibits increased affinity for and decreased ability to be activated by Gs-protein-coupled receptors as well as decreased ability to activate adenylyl cyclase.DepositorInsertG protein alpha-s with alpha-i2 substitutions in alpha3/beta5 loop (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T in alpha-s sequ…PromoterCMVAvailable SinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
G protein alpha-s(alpha3beta5/G226A)
Plasmid#55798PurposeIn addition to the mutations in alpha-s(alpha3beta5), this dominant negative G protein alpha-s mutant contains the G226A mutation, which impairs activating conformation changes in Switch II.DepositorInsertalpha-s (alpha3beta5/G226A) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A in alpha…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
GNAS_pLENTI-CAG-IRES-GFP
Plasmid#176991PurposeMammalian lentiviral expression vector encoding GNASDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH015_AAVS1_puro-pA-core-9xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179437PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL012_AAVS1-puro-9xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179429PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertTRE-cit-5kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bxb1Donor_G102H_ADRB2_LucReporter
Plasmid#129794Purposeencodes a donor vector for recombination with the Bxb1 recombinase with variant G102H of the Beta-2 Adrenergic Receptor and a cAMP-responsive luciferase reporter geneDepositorInsertADRB2 (ADRB2 Human)
UseSynthetic BiologyTags3x FLAGExpressionMammalianMutationG102HPromoterN/AAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEAHISPApqsE
Plasmid#97019PurposeExpressing Pseudomonas aeruginosa pqsE proteinDepositorInsertQuinolone signal response protein
TagsN-ter TEV protease cleavable 6HIsMutationnonePromoterT7Available SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF086 MBP-CREB 127-135-His
Plasmid#154075PurposeExpresses MBP-CREB_127-135-His (human 9aa CREB peptide as a fusion protein with MBP and His- tags) in E.coliDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-HK2 (D209A, D657A)-3xFLAG
Plasmid#239244PurposeHK2 lentiviral overexpression vectorDepositorInsertHK2 (HK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only