We narrowed to 10,763 results for: ESP
-
Plasmid#244186PurposePiggyBac transposon vector for expression of dsRedExpress2 under synTF promoter; constitutive expression of IL-10Rb NTEVp chain, IL-10Ra CTEVp chain, and mNeonGreen-P2A-PuroR selection markerDepositorInsertdsRedExpress2 under synTF responsive promoter; IL-10Rb NTEVp chain with human CD8a SS; IL-10Ra CTEVp chain; mNeonGreen-P2A-PuroR (CD8A Synthetic, Human)
UseSynthetic BiologyTags3xFLAGExpressionMammalianMutationNTEVp_75S, CTEVp_190KPromoterhEF1aAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12deltaNTD /Cyclin K
Plasmid#231741PurposeProtein expression in insect cellsDepositorTagsFlag-3CExpressionInsectMutationCDK12(700-1490)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12deltaCTD/Cyclin K
Plasmid#231742PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12-KiD/Cyclin K
Plasmid#231743PurposeProtein expression in insect cellsDepositorTagsFlag-3CExpressionInsectMutationCDK12(700-1082)Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
7AA-aSyn-pRK172
Plasmid#236197PurposeThis plasmid expresses human α-synuclein with a 7-amino acid insertion (MAAAEKT) in the pRK172 backbone for bacterial expression in E. coli. The insertion corresponds to the JOS mutation.DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-HA-MycΔdeg1∆deg2
Plasmid#231243PurposeHA-tagged MYC over-expession construct with point mutations corresponding to the deletion of degron 1 and 2 for transient expression in mammalian cellsDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-K36M TAIL[1-44]-3AID-HA-2A-mCherryBSD
Plasmid#225872PurposeLentiviral expression of AID degron tagged H3.3(K36M) histone tail corresponding to amino acids 1-44 and mCherry fused BlasticidinRDepositorUseLentiviral and Synthetic BiologyTags3xAID HA and T2A-mCherryExpressionMammalianMutationamino acids 1-44 from H3.3 K36MAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-YTHDF2-Malat1
Plasmid#216858PurposeCIRTS RNA targeting system for targeted knockdown of m6A-containing Malat1 at the synapse. CIRTS-YTHDF2-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-YTHDF2-Calm3-U6-Malat1 gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-Malat1
Plasmid#216860PurposeCIRTS RNA targeting system for targeted removal of m6A on Malat1 at the synapse. CIRTS-FTO-Calm3 and Malat1 gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-Malat1 gRNA
UseLentiviralExpressionMammalianPromoterSyn1, U6Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS FP>IA-HA-GFP
Plasmid#199688PurposeExpression of LYCHOS FP>IA mutant in insect cellsDepositorInsertLYCHOS (GPR155 Human)
Tags10xHis, 6xHis, EGFP, HA, and HRV 3CExpressionInsectMutationF43 and P44 mutated to I and A respectivelyAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLY168
Plasmid#184142PurposeReporter circuit for hijacking mRNA of arsenic responsive gene cluster as CRISPR RNA (site 2)DepositorInsertsdCas9
tetR
pspFΔHTH::λN22plus
sfgfp
rhaS
UseSynthetic BiologyTagsASV tag and λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPcon, PpspA-Ar2, PrhaB, and PtetAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH005_phiC31_neo-core-5xTetO-pEF-H2B-mCitrine-core-pRSV-H2B-mCherry
Plasmid#179433PurposeDual fluorescent reporter construct with double core HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertcoreHS4-TRE-cit-coreHS4-mch (DC)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL008_phiC31_neo-5xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179426PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-5kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH010_phiC31_neo-5xTetO-pEF-H2B-mCitrine-1.2kb,lambda-pRSV-H2B-mCherry
Plasmid#179427PurposeDual fluorescent reporter construct with 1.2kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-1.2kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_DED/AAA 535-888 USP7
Plasmid#131255PurposeMammalian expression of USP7 UBL domains 1-3, with an N-terminal Myc tag and mutations in UBL2 (corresponding to DE758AA_D764A of the full-length protein)DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationA mutant form of our pcDNA3.1-N-Myc_535-888 USP7 …Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
KHBD00450
Plasmid#39563DepositorAvailable SinceAug. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
pRS2 (CK2alpha', CK2beta)
Plasmid#27093DepositorUseTetracycline-regulated expressionTagsHA and MycExpressionMammalianPromoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ICUE4
Plasmid#181846PurposeFourth-generation FRET-based Indicator of cAMP Using Epac. Genetically encoded cAMP indicator. Contains high-sensitivity Epac Q270E mutation.DepositorInsertICUE4 (RAPGEF3 Human)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUW-VenusFlag-hCD44
Plasmid#211824PurposeExpress CD44 in mammalian cellsDepositorInsertCD44 (CD44 Human)
UseLentiviralTagsN-Terminal Venus and Flag tagsExpressionMammalianMutationisoform corresponds to UniProt ID P16070-1 with a…Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-GFP
Plasmid#66083PurposeG protein alpha-s internally tagged with EGFP and EE epitopeDepositorInsertG-alpha-s-EE-EGFP (Gnas Rat)
TagsEGFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-CFP
Plasmid#55793PurposeG protein alpha-s internally tagged with ECFP and EE epitopeDepositorInsertG-alpha-s-EE-ECFP (Gnas Rat)
TagsECFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationHis was substituted for Asn164 in ECFP (Clontech)…PromoterCMVAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-K627R_EGFP-PEST_reporter
Plasmid#172597PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-K627R mutant signaling.DepositorInsertmyc-PDGFRA-K627R (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-K627RPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIα-ICUE4
Plasmid#181848PurposeICUE4 cAMP sensor tethered to the PKA RIα subunit.DepositorTagsECFP, PKA RIα, and cpVenus(L194)ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCherry
Plasmid#66968PurposeG protein alpha-s internally tagged with mCherry and EE epitopeDepositorInsertG-alpha-s-EE-mCherry (Gnas Rat, Discosoma sp.)
Tagsinternal EE epitope (residues 189-194 in alpha- s…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-DnaJB1-PKAcat(K72H)-mCherry
Plasmid#181851PurposemCherry-tagged DnaJB1-PKA catalytic subunit fusion; contains catalytically dead PKA; for mammalian expression.DepositorTagsmCherryExpressionMammalianMutationLysine 128 in the DnaJB1-PKAcat fusion changed to…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLUE-SHLD2
Plasmid#114118PurposeExpresses N-terminally tagged Streptag-HA-CBP-SHLD2 in mammalian cellsDepositorInsertSHLD2 (SHLD2 Human)
TagsHA tag, Streptavidin-binding tag (Streptag), and …ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGV7 (CK2alpha' K69M, CK2beta)
Plasmid#27095DepositorUseTetracycline-regulated expressionTagsHA tag on CK2alpha' and Myc on CK2betaExpressionMammalianMutationK69M on CK2alpha'Promoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Ubc-rtTA-I2G
Plasmid#70076Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSilent mutations are introduced to escape from RN…PromoterTet responsible promoterAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-R914W_EGFP-PEST_reporter
Plasmid#172596PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-R914W mutant signaling.DepositorInsertmyc-PDGFRA-R914W (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-R914WPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Y102A-Ubc-rtTA-I2G
Plasmid#70075Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 (RRM mutant) in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationY102A. Silent mutations are introduced to escape …PromoterTet responsible promoterAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET3a-SF-LMNC-TS
Plasmid#169374PurposeE. coli expression plasmid for human LMNA residues 31-542, corresponding to the shorter lamin C isoform lacking the unstructured head, with an N-terminal splitFlAsH tag and a C-terminal TwinStrep tag.DepositorInsertLMNA residues 31-542 (LMNA Human)
TagsSplit-FlAsH Tag and TwinStrep TagExpressionBacterialMutationdeleted amino acid 1-30 (unstructured head domain…PromoterNative pET3a promotorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) CRIP2
Plasmid#107509PurposeExpressing CRIP2, puromycin resistantDepositorInsertCRIP2 (codon optimized) (CRIP2 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCerulean
Plasmid#66084PurposeG protein alpha-s internally tagged with mCerulean and EE epitopeDepositorInsertG-alpha-s-EE-mCerulean (Gnas Rat, Aequorea victoria)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-RXRa-Myc; pGK-H2B-RFP
Plasmid#242887PurposeFor lentiviral overexpression of Myc-tagged human RXRa coupled to H2B-RFP (in the opposite direction)DepositorInsertRxra (RXRA Human)
UseLentiviralTagsH2B-mRFPExpressionMammalianMutationHuman RXRa cDNA was PCR-amplified from pSV-Sport-…PromoterTetracycline response element upstream of a minim…Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAtVPZv1.0
Plasmid#233147PurposeExpresses VDE, PsbS, ZEP from A.thalianaDepositorInsertsExpressionPlantPromoterFBA-2, GAPA-1, Rbcs1a, and mas promoterAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
p21(dPCNA)-mCerulean-NeoR
Plasmid#215082PurposeExpressesp21(dPCNA)-mCerulean in mammalian cells.DepositorInsertCDKN1A (CDKN1A Human)
TagsmCeruleanExpressionMammalianMutationp21(dPCNA) denotes mutations M147A, D149A, F150A.PromoterCMVAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-D842V_EGFP-PEST_reporter
Plasmid#172598PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-D842V mutant signaling.DepositorInsertmyc-PDGFRA-D842V (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-D842VPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-D842V+R914W_EGFP-PEST_reporter
Plasmid#172599PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-D842V+R914W mutant signaling.DepositorInsertmyc-PDGFRA-D842V+R914W (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-D842V+R914WPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-K627R+R914W_EGFP-PEST_reporter
Plasmid#172600PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-K627R+R914W mutant signaling.DepositorInsertmyc-PDGFRA-K627R+R914W (PDGFRA Synthetic, Human)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-K627R+R914WPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-GNAS-T225P
Plasmid#116406PurposeLentiviral expression of GNAS T225PDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gs(short)-CASE
Plasmid#168124PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein Gs. Composed of the subunits G alpha s(short isoform) (GNAS) tagged with NanoLuciferase, G beta 1 (GNB1) and Venus-tagged G gamma 1 (GNG1).DepositorUseLuciferaseTagscpVenus on GNG1ExpressionMammalianMutationNLuc is inserted at N136/V137 within GNASAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro-Q306A
Plasmid#177334Purposebacterial expression of active SARS-CoV-2 3C-like proteinaseDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsFactor Xa site-3xFlag-Myc-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceNov. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits