We narrowed to 2,336 results for: control GFP
-
Plasmid#170084PurposeGFP expression under the control of E. coli dnaK promoter engineered with IR3 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR3Available SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PdnaK-IR2 GFP pZa
Plasmid#170081PurposeGFP expression under the control of E. coli dnaK promoter engineered with IR2 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR2Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_vhhGFP4::T48-Baz::mCherry
Plasmid#163927PurposeExpression of GrabFP-A-extracellular under control of UAS or LOP enhancerDepositorInsertFusion of vhhGPF4 (extracellular) nanobody with T48 protein, Bazooka minimal localization sequence and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHsa.NFKB:d2EGFP
Plasmid#239990PurposeDestabilized green fluorescent protein (d2EGFP) under transcriptional control of NF-kB activityDepositorInsertDestabilized EGFP
Promotercfos minimal promoterAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4QE2Crimson
Plasmid#218280PurposeIntroduction of a bicistronic expression cassette of yEGFP and E2Crimson under the control of the SkGAL2 promoterDepositorInsertpURA3>KlURA3>tKlURA3-pSkGAL2>yEGFP>ERBV1.2A>E2Crimson>tURA3
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF
Plasmid#101773PurposeExpresses BAF in human cells (with EGFP produced from the same transcript as expression control)DepositorAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_L58R
Plasmid#101775PurposeExpresses mutant BAF (L58R) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationL58R mutationPromoterEF1aAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
cpGFP-Adhiron_flex
Plasmid#165044PurposeFlexible linker control for POLArISact expression in mammalian cellsDepositorInsertcpGFP-Adhiron (connected with a flexible linker)
TagsHAExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT-EGFP-V5
Plasmid#240240PurposeExpression of EGFP-V5 under control of copper-inducible promoter.DepositorInsertEGFP-V5
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415GPD-EGFP
Plasmid#166137PurposeEGFP expression under the control of the GPD promoter yeastDepositorInsertEGFP
ExpressionYeastPromoterGDPAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry GFP
Plasmid#78535PurposeControl plasmid (paired gRNAs against GFP)DepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV/L7-6-GFP-WPRE
Plasmid#126462PurposeAn AAV vector that expresses GFP under the control of the L7-6 promoter. The L7-6 promoter is the short size (0.8-kb) and has highly specificity to Purkinje cells.DepositorInsertL7-6, Purkinje cell specific promoter
UseAAVExpressionMammalianAvailable SinceMay 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-EF1α-EGFP
Plasmid#21320PurposeControl Lentiviral vector with strong EF1a promoter, expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterEF1αAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
PL-SIN-PGK-EGFP
Plasmid#21316PurposeControl Lentiviral vector with ubiquitous PGK promoter, expresses EGFPDepositorInsertEnhanced Green Fluorescence Protein
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJune 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCAIP-hXRCC1pd-eGFP
Plasmid#206033PurposeMammalian expression of PAR-deficient hXRCC1pd coupled to eGFP under the control of a CAG promoterDepositorInserthXRCC1
TagseGFPExpressionMammalianMutationS103A,R186A,S184A,S193A,S219A,S220A,S236A,S268APromoterCAGAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-mXRCC1pd-eGFP
Plasmid#206035PurposeMammalian expression of PAR-deficient mXRCC1pd coupled to eGFP under the control of a EF1a promoterDepositorInsertmXRCC1pd
TagseGFPExpressionMammalianMutationS105A, S186A, K188A, S195A, S221A, S222A,S238A, S…PromoterEf1aAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
CaMKIIP-mEGFP-P2A-paAIP2/pAAV
Plasmid#91718PurposeAAV-mediated expression of mEGFP and paAIP2 for optogenetic control of CaMKIIDepositorInsertmEGFP-P2A-paAIP2
UseAAVPromoterCaMKII 1.3Available SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-GFP-2A-SynmRuby
Plasmid#166608PurposeEncodes Cre-dependent GFP-2A-synaptophysinmRuby under control of the TREDepositorInsertGFP-2A-syn
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-mEGFP(A206K)-paCaMKII(K42M)
Plasmid#165440PurposeExpresses photoactivatable CaMKII(K42M: Kinase dead) in mammalian cells as a negative control.DepositorInsertmEGFP(A206K)-paCaMKII(K42M)
TagsmEGFP(A206K)ExpressionMammalianMutationK42M: Kinase dead mutationPromoterCMVAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-FLPo-T2A-GFP
Plasmid#161766Purposeexpress FLPo and GFP under the control of human synapsin promoterDepositorInsertsFLPo
T2AEGFP
UseAAVExpressionMammalianPromoterhSynapsin1Available SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-L10a
Plasmid#166605PurposeEncodes Cre-dependent eGFP-L10a under control of the TREDepositorInserteGFP-L10a
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
Empty(Ctrl)-eGFP-PGK-H2BRFP
Plasmid#241864PurposeControl for epicenter-driven fluorescent reportersDepositorInserteGFP
UseLentiviralExpressionMammalianAvailable SinceOct. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PdnaK-IR2-IR2 GFP pZa
Plasmid#170083PurposeGFP expression under the control of E. coli dnaK promoter engineered with double IR2 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR2-IR2Available SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TET-GFP-FF3
Plasmid#11662Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP-mirNega
Plasmid#163705PurposepAAV plasmid to induce expression of universal negative control micro-RNA and EGFPDepositorInsertmirNega and EGFP
UseAAVPromoterCAGAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-FF3
Plasmid#11663Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with CMV promoter controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_VHH-GFP4::CD8::mCherry
Plasmid#163917PurposeExpression of a membrane-tethered GFP-nanobody marked by mCherry under control of the UAS or LOP enhancersDepositorInsertFusion of vhhGPF4 nanobody with mouse CD8 transmembrane protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMGS36 (GFP-ARF16-PB1)
Plasmid#126581PurposeConstruct to express GFP-ARF16-PB1 under the control of the CMV promoterDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAT9650-BEAR-GFP-preedited
Plasmid#162992PurposeBEAR control plasmid with split EGFP and intact 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-mito
Plasmid#229693PurposeTransient expression of EGFP AP4-mito in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (mitochondria)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TREX-GFP-FF3
Plasmid#11667Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-cyto
Plasmid#229694PurposeTransient expression of EGFP AP4-cyto in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (cytoplasm)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S::SP-mCherry-GFP-HDEL
Plasmid#159097PurposePositive control for FRET in plant ER / nuclear envelope.DepositorInsertSP-mCherry-GFP-HDEL
TagsmCherry, GFPExpressionPlantPromoter35SAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_Hyg_FLAG-BirA-eGFP-NLS2
Plasmid#170917PurposeExpresses FLAG-BirA-eGFP-NLS2 to be used as control in BioID or FLAG pull downDepositorInsertFLAG-BirA-eGFP-NLS2
TagsBirA-FLAGExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-DsRed_IRES_EGFP
Plasmid#92194PurposeLentiviral overexpression vector to make stable bicistronic cell line for control (EGFP) screenDepositorInsertDsRed-IRES-EGFP
UseLentiviralExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX GFP-HA
Plasmid#229501PurposeControl HA-tagged protein for immunoprecipitation experiments.DepositorInserteGFP
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-EGFP
Plasmid#166143PurposeEGFP expression under the control of the Galactose-inducible promoter in yeast. Contains 2 um element for high copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX
Plasmid#181873PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoterDepositorInsertsUseAAV and AdenoviralTagsHA and mycExpressionMammalianPromotersynthetic hybrid CAG promoter and synthetic hybri…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-dt/deltaEGFP
Plasmid#163919PurposePGK-driven dTomato expression. Lacks the CBA-promoter controlling EGFP expression.DepositorInsertdtomato
UseLentiviralExpressionMammalianMutationWTAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SV40.eGFP.SV40(polyA)
Plasmid#195558PurposeExpresses eGFP under control of short GFAP promoterDepositorInserteGFP
UseAAVTagsNo tagsExpressionMammalianPromotershort GFAPAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PH-Btk(R28C)-GFP
Plasmid#51464PurposeNon-PIP3 binding control for PH-Btk-GFPDepositorAvailable SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-mEGFP-dspB(E184Q W330Y)-6xHis
Plasmid#176575PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAvitag, Hexahistidine tag, and mEGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only