We narrowed to 23,593 results for: promoter
-
Plasmid#44105DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pRK-flag-GFP 1-10 tetra Cys
Plasmid#78589PurposeExpression flag-GFP 1-10 tetra Cys in mammalian cellsDepositorInsertflag-GFP 1-10 tetra Cys
TagsflagExpressionMammalianPromoterCMVAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCK300
Plasmid#87766Purposeempty control plasmid, three terminators to place inserts between for insulation, ampR, pBR322 origin, lacIDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoterNoneAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-mCherry
Plasmid#66533PurposeExpresses mCherry under the control of Mutant T7 Promoter G6DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialMutationCodon Optimized for E. coliPromoterMutant T7 Promoter - G6Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJJF439_PU6_empty_sgRNAscaffold - sgRNA cloning backbone
Plasmid#164266PurposesgRNA cloning backbone for expression of sgRNA in C. elegans. Contains BbsI sites for insertion of spacer sequences. U6 promoter from W05B2.8 gene.DepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6 promoter from W05B2.8Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
attB-P7-attP-YFP
Plasmid#195571PurposeA strong P7 promoter flanked by Bxb1 recombination sites attB and attP. Downstream of attP is a strong RBS and YFP coding sequence.DepositorInsertPromoter flanked by Bxb1 recombination sites attB and attP with YFP downstream
UseSynthetic BiologyPromoterP7Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
secCitrine
Plasmid#181964PurposeBasic chitinase signal peptide fused to Citrine, under control of MUM4_1.5kb promoterDepositorInsertsignal peptide sequence from basic chitinase
TagsCitrine YFPExpressionPlantPromoter1.5 kb MUM4 promoterAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3_4xUAS_CP-candidate_luc+
Plasmid#125154PurposeSTAP-seq luciferase validation vector, which harbors an 4x UAS array upstream of the CP position (candidates are inserted at CP position) for the recruitement of GAL4-DBD tagged proteinsDepositorInsert4 x upstream activating sequence (UAS)
UseLuciferaseAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG#707
Plasmid#110911PurposeExpresses the C. elegans sup-1(e995) minigene in ventral nerve cord cholinergic motor neuronsDepositorInsertsup-1 minigene
ExpressionBacterialAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXD70LacZ3-Pcsd-LacZ
Plasmid#191619PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), Pcsd promoter-lacZ, E. lenta constitutive promoterDepositorInsertlacZ
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFlox_N-BRG1_Neo_FKBPF36V_mScarlet
Plasmid#163875PurposeAcute Depletion of BRG1-mScarletDepositorInsertBrg1 (Smarca4 Mouse)
ExpressionMammalianAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM6-H9-mCherry
Plasmid#66532PurposeExpresses mCherry under the control of Mutant T7 Promoter H9DepositorInsertmCherry
UseSynthetic BiologyExpressionBacterialMutationCodon Optimized for E. coliPromoterMutant T7 Promoter - H9Available SinceJuly 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcry:GFP,-503unc:hACTA1GFP
Plasmid#172529PurposealphaA-crystallin promoter (cry) drives GFP expression in the lens. The 503bp unc-45b muscle-specific promoter drives expression of GFP-tagged human ACTA1.DepositorInsertATCA1
ExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Or30a-Gal4
Plasmid#63027PurposeTo express Gal4 in the pattern of the Drosophila melanogaster odorant receptor Or30a, using the promoter sequences of the gene cloned 5' of Gal4DepositorInsertDrosophila melanogaster Or30a promoter
TagsDrosophila ADH (aa's 1-18) fused to Yeast Ga…ExpressionInsectAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWZL blast goosecoid
Plasmid#14095DepositorAvailable SinceFeb. 22, 2007AvailabilityAcademic Institutions and Nonprofits only -
3158 pSFFV-neo Bad cDNA
Plasmid#8753DepositorAvailable SinceJuly 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pTL472
Plasmid#69882PurposedCirl promoter region was replaced with an optimized 20xUAS-IVS promoter cassetteDepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL ∆CC
Plasmid#80268Purposemammalian expression plasmid for MycLAP-STIL coiled-coil deletionDepositorInsertSTIL (STIL Human)
TagsMyc-GFPExpressionMammalianMutationmissing conserved coiled-coil (amino acids 721-74…PromoterCMVAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
C513-E07: attB5r-<p10p-polyhedrinp>-attB1r
Plasmid#162949PurposeGateway attB5r/attB1r entry clone containing divergent AcMNPV polyhedrin and p10 promoters, for use in construction of polycistronic baculovirus expression vectorsDepositorInsertdual baculovirus promoter cassette (AcMNPV p10 and polyhedrin)
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only