We narrowed to 79,094 results for: Mycs;
-
Plasmid#69010Purposeactivating MTOR mutationDepositorInsertMTOR-F1888L (MTOR Human)
UseTagsFLAGExpressionMammalianMutationchange Phenylalanine 1888 to LeucinePromoterAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYL236
Plasmid#173184PurposeCRISPR donor plasmid for making the WT EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorInsertEZH2 (EZH2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-promoter-mIL-6
Plasmid#109296PurposeIL-6 promoter reporter constructDepositorInsertmurine IL-6 promoter (Il6 Mouse)
UseTagsExpressionMammalianMutationCMV promoter in pEGFP-N1 replaced with murine IL-…Promotermurine IL-6 promoterAvailable sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR-U6gRNA-PGKpuro2ABFP
Plasmid#136405PurposeDonor vector for gRNA subcloning. Required for gRNA cloning into the RCAS-DV. Also constitutively expresses Puromycin linked to TagBFP.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationBbsI restriction site at position 437 was removed…PromoterU6, PDKAvailable sinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSc-His6-Sem1Sc
Plasmid#83235PurposepGREG600-His6-Sem1Sc, Expresses the His6-Sem1 in yeastDepositorInsertSem 1 (SEM1 Budding Yeast)
UseTagsHis6ExpressionYeastMutationPromoterAvailable sinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
UseTags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
UseTags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-D2512H
Plasmid#69017Purposeactivating MTOR mutationDepositorInsertMTOR-D2512H (MTOR Human)
UseTagsFLAGExpressionMammalianMutationchange Aspartate 2512 to HistidinePromoterAvailable sinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
UseTagsExpressionBacterial and YeastMutationPromoterpADH1Available sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationPromoterPTETREGAvailable sinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
UseTags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
UseTags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
UseTagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-EKAR-EV
Plasmid#123341PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertmCherry-mCherry-FLARE-EKAR-EV
UseTags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianMutationPromoterCMVAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pA-CBh-TP-(inactive)CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209937PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209938PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6 andNOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209939PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD1178-LPDV promoterless PuroR-P2A-miRFP720
Plasmid#201537PurposeLanding pad destination vector for mMoClo golden gate-based assembly of landing pad integration vectors; contains BxB1 attB site, promoterless puromycin resistance gene and miRFP720 geneDepositorInsertPromoterless PuroR-P2A-miRFP720
UseTagsExpressionMammalianMutationPromoterNoneAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBSII-PGK-FLPo-IRES-Puro
Plasmid#205989PurposeExpresses Flp recombinase and puromycin resistanceDepositorInsertsUseTagsExpressionMammalianMutationPromoterPGK promoterAvailable sinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPtipA; sgRNA expression from SF14P promoterAvailable sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyTagsExpressionMutationPromoterPtipA; sgRNA expression from kasOP* promoterAvailable sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-P1K-3VSV-Atg8(L55W T56A V61W R65A)-MET15
Plasmid#207054PurposeExpression of 3VSV-Atg8 point mutant. Uses auxotrophic marker MET15(Saccharomyces cerevisiae).DepositorInsertATG8
UseTags3xVSVExpressionYeastMutationL55W T56A V61W R65APromoterAvailable sinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
Plasmid#212805PurposeConstitutive or doxycycline-inducible expression of NUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7 in mammalian cellsDepositorInsertNUbo-E3(48)-mCherry-P2A-3xFLAG-Ubc7
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF3447
Plasmid#144923PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertMYCBP (MYCBP Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEE054
Plasmid#176811PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert605
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only