We narrowed to 16,460 results for: GRN
-
Plasmid#115773PurposeExpression of the extracellular domain of NGRN with N-terminal FLAG tag and C-terminal hIgG tag.DepositorAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAC103-PBNeo-U6-sgRNA-Expression
Plasmid#48228PurposesgRNA expression on PiggyBac vector with Neo-selectable markerDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceApril 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA1-28-pA
Plasmid#55200PurposePlasmid encoding the Triplex/gRNA architecture.This is a modified form of the original plasmid described in the paper (Construct 3). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti sgRNA(MS2) mCherry
Plasmid#171053PurposeExpression of Vp64-dCas9 activation systemDepositorInsertsgRNA(MS2) mCherry
UseLentiviralExpressionMammalianAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato SOX2-sgRNA
Plasmid#196190PurposeEditing human SOX2 locusDepositorInsertSOX2 (SOX2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA(lib)-puro
Plasmid#119976PurposeLenti sgRNA cloning backbone with CMV-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR8-PspCas13b_gRNA[ccdbCam]_1xMS2b
Plasmid#196847Purposebackbone for gRNA cloning of dpspCas13b tagged by 1xMS2DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP
Plasmid#62348PurposeAn empty optimized gRNA expression vectorDepositorInsertnone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AZsG-W
Plasmid#67975PurposeCRISPR gRNA expression vector with an improved scaffold and puro/ZsG markersDepositorInsertU6gRNA cassette, PGKpuro2AZsG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Puro
Plasmid#167911PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-EGFP_cU6:6-sgRNA
Plasmid#190597PurposeThe plasmid encodes S. pyogenes Cas9 and eGFP separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoter.DepositorInsertsCas9
sgRNA
UseCRISPRTagsEGFP - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only