-
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_shuffle_3_mCh-2xFKBP (pBS1119)
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOE_HUMAN_A234G (pBS0816)
Plasmid#185267PurposeFor the mammalian expression of the human protein APOE_HUMAN_A234G. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOE_HUMAN_A234G
UseTagsExpressionMammalianMutationA234GPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_93-127 (pBS0735)
Plasmid#185231PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_93-127. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_93-127
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_D4NWF2_DrHD_b03_dom3 (pBS0681)
Plasmid#185207PurposeFor the mammalian expression of the Deinococcus radiodurans protein D4NWF2_DrHD_b03_dom3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertD4NWF2_DrHD_b03_dom3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_APOA4_ANDDA_21-367 (pBS0742)
Plasmid#185234PurposeFor the mammalian expression of the Chinese giant salamander protein APOA4_ANDDA_21-367. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertAPOA4_ANDDA_21-367
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q7JLY3_CAEEL_48-124 (pBS0738)
Plasmid#185232PurposeFor the mammalian expression of the C. elegans protein Q7JLY3_CAEEL_48-124. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ7JLY3_CAEEL_48-124
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-88 (pBS0734)
Plasmid#185230PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-88. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-88
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_Q19228_CAEEL_51-127_noLink (pBS0733)
Plasmid#185229PurposeFor the mammalian expression of the C. elegans protein Q19228_CAEEL_51-127_noLink. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertQ19228_CAEEL_51-127_noLink
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_5 (pBS0731)
Plasmid#185228PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_5
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_3 (pBS0729)
Plasmid#185227PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_shuffle_1 (pBS0727)
Plasmid#185226PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_shuffle_1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_5 (pBS0722)
Plasmid#185225PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_5. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_5
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_3 (pBS0720)
Plasmid#185224PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_mutant_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_23 (pBS0719)
Plasmid#185223PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_23. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_23
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_22 (pBS0718)
Plasmid#185222PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_22. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_mutant_22
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_21 (pBS0717)
Plasmid#185221PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_21. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_21
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_2 (pBS0715)
Plasmid#185220PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_2. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_2
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_17 (pBS0712)
Plasmid#185219PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_17. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_17
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_16 (pBS0711)
Plasmid#185218PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_16. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_16
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_14 (pBS0709)
Plasmid#185217PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_14. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertpvLEA22mer_mutant_14
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_pvLEA22mer_mutant_10 (pBS0705)
Plasmid#185216PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10. This is one of the top performing targets in our apoptosis assay (it protected from apoptosis).DepositorInsertpvLEA22mer_mutant_10
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H2FLK5_CAEEL_199-435 (pBS0696)
Plasmid#185215PurposeFor the mammalian expression of the C. elegans protein H2FLK5_CAEEL_199-435. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertH2FLK5_CAEEL_199-435
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_H2FLK5_CAEEL_542-800 (pBS0695)
Plasmid#185214PurposeFor the mammalian expression of the C. elegans protein H2FLK5_CAEEL_542-800. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertH2FLK5_CAEEL_542-800
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_b03-dom3_opt2 (pBS0693)
Plasmid#185213PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_b03-dom3_opt2. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDrHD_b03-dom3_opt2
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_DrHD_b03-dom3_opt1 (pBS0692)
Plasmid#185212PurposeFor the mammalian expression of the Deinococcus radiodurans protein DrHD_b03-dom3_opt1. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertDrHD_b03-dom3_opt1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only