We narrowed to 8,093 results for: gnal
-
Plasmid#213289PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR63 (GPR63 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR174-DuET
Plasmid#213271PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR174 (GPR174 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR182-DuET
Plasmid#213272PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR182 (GPR182 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR160-DuET
Plasmid#213268PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR160 (GPR160 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPR12-DuET
Plasmid#213260PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR12 (GPR12 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPBA-DuET
Plasmid#213255PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPBA (GPBAR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FPR2-DuET
Plasmid#213240PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertFPR2 (FPR2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CYSLTR2-DuET
Plasmid#213226PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCYSLTR2 (CYSLTR2 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMKLR1-DuET
Plasmid#213212PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCMKLR1 (CMKLR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRB1-DuET
Plasmid#213180PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertADRB1 (ADRB1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRA2B-DuET
Plasmid#213178PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertADRA2B (ADRA2B Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EFNB2 (D62Q)
Plasmid#200976PurposeMammalian expression plasmid for myc-tagged EFNB2 (D62Q specificity mutant)DepositorInsertEFNB2 (EFNB2 Human)
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationD62Q (increases specificity towards henipaviral G…PromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-bio-myc-mCE 211-597
Plasmid#112716PurposeExpresses N-terminally bio-myc-tagged mouse CE/Rngtt 211-597 in mammalian cellsDepositorInsertRngtt (Rngtt Mouse)
UseTagsbiotinylation signal peptide (Tagwerker et al. 20…ExpressionMammalianMutationdeleted amino acids 2-210 (triphosphatase domain)PromoterCMVAvailable sinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-Nb127D01-mCherry-KDEL
Plasmid#171575PurposeExpresses mCherry-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-mCherry) in fly cell ER membraneDepositorInsertBiP-Nb127D01-mCherry-KDEL (CXCR2 Human)
UseTagsBiP signal peptide and mCherry-KDELExpressionInsectMutationPromoterfly actin5C promoterAvailable sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-NbVHH05-mCherry-KDEL
Plasmid#171574PurposeExpresses mCherry-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-mCherry) in fly cell ER membraneDepositorInsertBiP-NbVHH05-mCherry-KDEL (UBE2J1 Human)
UseTagsBiP signal peptide and mCherry-KDELExpressionInsectMutationPromoterfly actin5C promoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal plyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
UseTagsGUS and mGFP5ExpressionPlantMutationPromoterCaMV 35SAvailable sinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(E1418K/A1419R/S1421R/P1424Q/Y1426S)
Plasmid#155010PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 E1418K/A1419R/S1421R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
UseTagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationE1418K/A1419R/S1421/P1424Q/Y1426S; insert codes f…PromoterCMVAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-TOM20MTS-DDRGK1-dTM-HA
Plasmid#139861PurposeLentiviral expression of TOM20MTS-DDRGK1-dTM-HADepositorInsertTOM20-MTS-DDRGK1-dTM (DDRGK1 Human)
UseLentiviralTagsHAExpressionMutationrecombinant fusion of mitochondria-targeting sign…PromoterAvailable sinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
Rescue myc-PCDHGC5 mRNA
Plasmid#122229PurposeRescue mRNA for Protocadherin gamma C5 knock down with sh1 shRNA (plasmid 122227). With five silent mutations at sh1 shRNA target site.DepositorInsertPCDHGC5 (Pcdhgc5 Rat)
UseTags9E10 cMyc epitope (EQKLISEEDL) was inserted betwe…ExpressionMammalianMutationSilent mutations are in five consecutive codons …PromoterAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-26b-Nb127D01-ALFA-His
Plasmid#171568PurposeBacterial expression of ALFA-His-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-ALFA-His)DepositorInsertNb127D01-ALFA-His (CXCR2 Human)
UseTagsALFA-tag/His-tag and PelB signal peptideExpressionBacterialMutationPromoterAvailable sinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRHR1-DuET
Plasmid#213215PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertCRHR1 (CRHR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai1-RLuc8
Plasmid#140973PurposeEncodes a G alpha subunit (GNAl1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai1-RLuc8 (GNAI1 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-SOD2-2A-Catalase-WPRE
Plasmid#67635PurposeAAV vector expressing both SOD2 and mitochondrial targeted CatalaseDepositorUseAAVTagsExpressionMutationDeleted the Peroxisome Targeting Signal from Cata…PromoterCMVAvailable sinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LPAR1-DuET
Plasmid#213329PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertLPAR1 (LPAR1 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Mito-Car-GECO
Plasmid#100765PurposeLentiviral tet-inducible expression of mito-targeted genetically encoded Ca2+-indicators for optical imagingDepositorInsertLenti-Mito-Car-GECO
UseLentiviralTagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationR-GECO1: E163V/I166V/V174T/M176I/F222I/A302PPromoterCMVAvailable sinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV hPGRN
Plasmid#213682PurposeExpresses human progranulin (PGRN) with an N-terminal twin-Strep-V5 tagDepositorInsertHuman Progranulin (hPGRN) (GRN Human)
UseAAVTagsTwin-Strep tag and V5 tag (after signal peptide)ExpressionMutationPromotercytomegalovirus enhancer/chicken β-actin promoterAvailable sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-proα2(I)-G610C
Plasmid#119827PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with Gly610Cys mutation and GFP between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
UseTagseGFPExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tag, Gly…PromoterCMVAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only