We narrowed to 11,248 results for: AGA
-
Plasmid#192184PurposeClone 16 (HH06) pFUSE-IgG1-Knob-mutation knob-clone6DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Clone 16 - 1 HH02 pFUSE-IgG1-Hole mutation-hole-clone2
Plasmid#192183PurposeClone 16 (HH02) pFUSE-IgG1-Hole mutation-hole-clone2DepositorInsertClone 2 heavy chain (HH02)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLX_307 FDX1
Plasmid#184495PurposeLentivirus expression for FDX1DepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M26-synNotch-Gal4VP64
Plasmid#247467PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertsynNotch receptor using a scFvs bindingΒ MOG
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-SMS1-TEV-HAT
Plasmid#202557PurposeExpress C-terminal Tobacco Etch Virus (TEV) protease cleavable HAT-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cellDepositorInsertSGMS1 (SGMS1 Human)
TagsHistidine-Affinity-tag (HAT) and TEV cleavable siβ¦ExpressionMammalianMutationdeleted stop codon (TAA)PromoterCAG and chicken Ξ²-actin promoterAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-Halo-hMRE11(wt)
Plasmid#208393PurposeTo generate stable cell line expressing Halo-human MRE11(WT) by Retroviral infection.DepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Retro-Puro-Drp1-shRNA
Plasmid#99385PurposeExpresses shRNA against human Drp1 from puromycin resistance retroviral vectorDepositorAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 mCherry-hCortKD-Flcortmut3YD
Plasmid#187266PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF mCherry
Plasmid#187265PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
FLAG-HA-FbxO5-pcDNA3.1-
Plasmid#52509Purposeexpresses human FbxO5 in mammalian cells with FLAG-HA tag at N-terminusDepositorAvailable SinceJuly 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-EWS-FLI1-KS
Plasmid#237671PurposeFor overexpression of mEGFP-EWS-FLI1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLT 651
Plasmid#59998PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans klp-16/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorExpressionBacterialMutationpartial genomicAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ΞΆ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBW2614_pCAG-PV1-GAI-L2-28-396-FlpO-ABI-NLS-BGHpA
Plasmid#108833PurposeExpresses aa28 to aa396 of Flp recombinase fused to GAI and ABI CIDsDepositorInsertFlp recombinase fragment aa28 to aa396
UseCre/Lox and Synthetic BiologyTagsABI,NLS and GAIExpressionMammalianPromoterpCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mGold2t-Lysosome-N-20
Plasmid#231778PurposeVisualization of lysosome in mammalian cells using mGold2tDepositorAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP KNL1 wt hardened and RVSF->AAAA
Plasmid#45225DepositorInsertGFP KNL1 with RVSF-AAAA mutation, resistant to KNL1 siRNA (KNL1 Human)
MutationRVSF mutated to AAAAAvailable SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) NRP1 b1 (273-427)
Plasmid#162734PurposeBacterial expression of the b1 domain from the human Neuropilin 1 receptor (NRP1). With an N-terminal 6His tag and thrombin cleavage site.DepositorInsertHuman NRP1 b1 domain residues 273-427
ExpressionBacterialMutationCodon optimisedAvailable SinceApril 27, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pscALPSpuro-MDA5-S88D
Plasmid#174226PurposeExpresses human MDA5 S88D mutantDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapsin1.OxLight-ctr
Plasmid#169793PurposeControl non-binding fluorescent reporter for orexin neuropeptidesDepositorInsertOxLight-ctr
UseAAVMutationE54K; T111APromoterhuman Synapsin-1Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only