We narrowed to 19,151 results for: Tat
-
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pCEP4-BaLgp140-TM
Plasmid#111843PurposeMammalian expression plasmid for extracellular gp140 from the BaL HIV-1 strain fused to a transmembrane tetherDepositorInsertHIV-1 (BaL) Env
TagsCD5 leader sequence and TM helix from MHC class IExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNAZeo(-)HSC73AS
Plasmid#86031PurposeAntisense for pCDNAZeo(-)HSC73DepositorAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETconNK-TEM1(S70A,D179G)
Plasmid#81166PurposepETconNK with TEM1(S70A,D179G) beta-lactamaseDepositorInsertTEM-1 beta-lactamase
Tagsc-mycExpressionBacterial and YeastMutationDeleted the sec transport tag. Plasmid encodes H2…PromoterGAL1 and gal1Available SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001146083)
Plasmid#76910Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mATP2B1
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-20b-M-Ntx-S1
Plasmid#58716PurposeExpresses in Escherichia coli Notexin with a N-terminal extra methionine and with the amino acid substitution N1SDepositorInsertNotexin
TagsMethionineExpressionBacterialMutationChanged Asparagine 1 to SerinePromoterT7Available SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3−3xFLAG−AGO2(D669A)
Plasmid#220461PurposeExpress catalytically-dead mutant human AGO2 with N-terminal 3xFLAG tag in mammalian cellsDepositorInsertHuman AGO2 (AGO2 Human)
Tags3xFLAGExpressionMammalianMutationAspartate 669 to alaninePromoterCMVAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/EGFP/pdCas9-C1
Plasmid#162759PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-MA-VN
Plasmid#123283PurposeMammalian expression plasmid for matrix domain of HIV-1 Gag fused to the N-terminal half of split fluorescent Venus (VN)DepositorInsertMatrix
TagsVN: N-terminus of split Venus (a.a. V1–A154) I152…ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
LUC2 (L/Sec/deltaP)
Plasmid#112145PurposeMammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activityDepositorInsertLuciferase coding region with Cysteine 258 mutated to selenocysteine (U) and deleted AUGA in PHGPx SECIS core (Gpx4 Rat, Photinus pyralis)
ExpressionMammalianMutationCysteine 258 mutated to selenocysteine (U) and d…Available SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUb-G76V-GFP-IRES-DsRed
Plasmid#225503PurposeExpression of Ub-G76V-GFP along dsRED from one mRNADepositorInsertUb-G76V-GFP
TagsGFPExpressionMammalianMutationUbiquitin fused to N-terminus of GFP. Glycine 76 …PromoterCMV promoterAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-EGFL7-Fc(DAPA)-AviTag-6xHis
Plasmid#156702PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertEGFL7 (EGFL7 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
SOX2 KO (T2A-H2B-EGFP)
Plasmid#167969PurposeSOX2 CDS replacement with T2A-H2B-EGFPDepositorInsertSRY-Box Transcription Factor 2 (SOX2 Human)
UseCRISPR; Donor templateTagsH2B-EGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro-BAP1-C91S-HA
Plasmid#154021PurposeMammalian Expression of HA-tagged p.C91S Mutant BAP1DepositorInsertBAP1 (BAP1 Human)
UseRetroviralTagsHemagglutinin (HA)ExpressionMammalianMutationp.C91S (Missense Mutation, Catalytically Inactive)Available SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSALECTNK-TEM1(S70A,D179G)/csTEM1
Plasmid#81163PurposepSALECT plasmid with TEM-1 beta-lactamase fused to TEM-1DepositorInsertTEM-1 beta-lactamase
TagsCodon swapped TEM-1 from H26 to W290 and His6xExpressionBacterialMutationDeleted the sec transport tag. Plasmid encodes H2…Promoterlac promoterAvailable SinceFeb. 21, 2017AvailabilityAcademic Institutions and Nonprofits only