We narrowed to 40,900 results for: Eras
-
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S285C
Plasmid#98666PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285C and D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S329C
Plasmid#98668PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with D290V and S329CDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_LC_R191K_R201K_R216K_R254K
Plasmid#104467Purposeexpress MBP hnRNPA2 LC with 4 R to K mutationsDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.110
Plasmid#99363PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.110.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationAlanine 18 to Threonine and Glutamic acid 31 to L…PromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
10xHis-ataxin-3 *SIM-HA
Plasmid#89983PurposeExpresses His- and HA-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorInsertataxin-3 (ATXN3 Human)
Tags10xHis and HAExpressionMammalianMutationmutated aa 162IFVV to 162AFAAAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-ataxin-3 *SIM
Plasmid#89979PurposeExpresses GFP-tagged ataxin-3 with a mutation in the SUMO-interacting motifDepositorAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
M3K5_HUMAN_D0
Plasmid#79710PurposeThis plasmid encodes the kinase domain of M3K5. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
DMPK_HUMAN_D0
Plasmid#79717PurposeThis plasmid encodes the kinase domain of DMPK. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
KC1G1_HUMAN_D0
Plasmid#79691PurposeThis plasmid encodes the kinase domain of KC1G1. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSK22_HUMAN_D0
Plasmid#79704PurposeThis plasmid encodes the kinase domain of CSK22. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK215
Plasmid#72427PurposeAcetobacter aceti 1023 gDNADepositorInsertssuccinyl-diaminopimelate desuccinylase
2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase
acetylglutamate kinase
ribosome biogenesis GTP-binding protein YsxC
insertase
ribonuclease P
50S ribosomal protein L34
hypothetical protein
glyoxylase I
hypothetical protein
UDP-N-acetylglucosamine acyltransferase
3-hydroxyacyl-ACP dehydratase
UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase
UsePhage lambda cloning vector with genomic dna inse…Mutationmissing C-terminal domain residues 277-391(ter) a…Promotern/aAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K2S
Plasmid#62980PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 446-911 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K3S
Plasmid#62981PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 911-1406 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K4S
Plasmid#62982PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 1406-1781 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K6S
Plasmid#62983PurposeTranslational reporter for KLF4DepositorInsertKLF4 partial sequence (KLF4 Human)
UseLuciferaseTagsfirefly luciferaseMutationFragment 2086-2639 of KLF4PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTight-9-124-BclxL
Plasmid#60857Purpose2nd generation lentiviral transfer plasmid. Expresses a synthetic cluster of miR-9/9* and miR-124 fused to Bcl-xL under a doxycycline-inducible promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRK5-EGFP-Tau
Plasmid#46904Purposeexpresses EGFP tagged Tau in mammalian cellsDepositorInsertMAPT (MAPT Human)
TagsEGFPExpressionMammalianMutationThis WT htau construct contains human four-repeat…PromoterCMVAvailable SinceJuly 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt2-90-43Q-P90C
Plasmid#114626PurposeBacterial expression of Htt fragment containing amino acids 2-90, with P90C cysteine mutation and a 43 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationP90C; 43 polyQ repeatAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIG-829_HA-GD2-28z_CAR_JUN_Retroviral
Plasmid#207506PurposeThis plasmid can be used to generate retrovirus.DepositorInsertJUN, HA-GD2-28z_CAR (JUN Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
3X FLAG-FUS-WT
Plasmid#44985DepositorAvailable SinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIG-830_HA-GD2-28z_CAR_tNGFR_Retroviral
Plasmid#207507PurposeThis plasmid can be used to generate retrovirus.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-pspCas13b-NES-3xFLAG-T2A-BFP
Plasmid#173029PurposeFor expression of cytoplasmic pspCas13b protein tagged with 3xHA-T2A-BFP for gene silencing in mamallian cells.DepositorInsertpspCas13b
UseCRISPR and LentiviralTags3xFLAG, BFP, HIV NES, and T2AExpressionMammalianPromoterEf1aAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293
Plasmid#118412PurposeExpresses firefly luciferase under the control of a strong ubiquitous promoter EF1a along with a WPRE cassette. Backbone is compatible with both baculoviral and human production methods of AAV.DepositorInsertFirefly luciferase
UseAAV, Luciferase, and Synthetic BiologyExpressionInsect and MammalianPromoterEF1aAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 a-syn A53T D115A mNeonGreen-3K-B11
Plasmid#232017PurposeBacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3KDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOBI C-FLAG PHGDH
Plasmid#212995Purposeexpresses human PHGDHDepositorAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-SFFV-GLuc-CreERT2-mCherry
Plasmid#178185Purposethe plasmid promotes the constitutive expression of CreERT2 to enable intracellular recombination, Gaussia Luc can be used for in vivo imaging and mCherry is used as a marker for ex vivo analyses.DepositorInsertsGLuc
CreERT2
mCherry
UseLentiviralAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-828_HA-GD2-28z_CAR_BATF_Retroviral
Plasmid#207505PurposeThis plasmid can be used to generate retrovirus.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only