We narrowed to 24,790 results for: SPR
-
Plasmid#154929PurposeaTc inducible HypaCas9DepositorInsertHypaCas9
UseCRISPR and Synthetic BiologyTagsssrAExpressionBacterialMutationN692A/M694A/Q695A/H698APromoterpTetAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL1045
Plasmid#129525PurposepDEF-SpCas9, Empty Vector for CRISPRi, PbEF1a promoter, 1st GenerationDepositorInsertdSpCas9 (Other)
UsePlasmodium, rodent-infectious speciesAvailable SinceSept. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PAJ408
Plasmid#104150PurposedCas9 plasmid expressing full length mKate2 mRNA without RBSDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterpLtetO-1Available SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-eCas9-D1135E
Plasmid#154926PurposeaTc inducible eCas9 with D1135E mutationDepositorInserteCas9-D1135E
UseCRISPR and Synthetic BiologyTagsssrAExpressionBacterialMutationK848A, K1003A, R1060A, D1135EPromoterpTetAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-OptiCas9-D1135E
Plasmid#154928PurposeaTc inducible OptiCas9 with D1135E mutationDepositorInsertOptiCas9-D1135E
UseCRISPR and Synthetic BiologyTagsssrAExpressionBacterialMutationR661A, K1003H, D1135EPromoterpTetAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9-D1135E
Plasmid#154931PurposeaTc inducible Cas9 with D1135E mutationDepositorInsertCas9-D1135E
UseCRISPR and Synthetic BiologyTagsssrAExpressionBacterialMutationD1135EPromoterpTetAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT11
Plasmid#223383PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTet-tns
Plasmid#170628PurposeExpression of CRISPR-associated transposasesDepositorInsertVchTnsABC
ExpressionBacterialAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTetQCas-8+IS186
Plasmid#170636PurposeExpression of CRISPR-associated transposasesDepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(8+IS186 array)
ExpressionBacterialAvailable SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRha-tns
Plasmid#170630PurposeExpression of CRISPR-associated transposasesDepositorInsertVchTnsABC
ExpressionBacterialAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSL1433
Plasmid#129523PurposepDEF-SpCas9::GFP, Empty Vector for RGR and HDR Template, PyBiP-minimal promoter, 3rd GenerationDepositorInsertSpCas9 (Other)
UsePlasmodium, rodent-infectious speciesAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAra-tns
Plasmid#170632PurposeExpression of CRISPR-associated transposasesDepositorInsertVchTnsABC
ExpressionBacterialAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-HypaCas9-D1135E
Plasmid#154930PurposeaTc inducible HypaCas9 with D1135E mutationDepositorInsertHypaCas9-D1135E
UseCRISPR and Synthetic BiologyTagsssrAExpressionBacterialMutationN692A/M694A/Q695A/H698A/D1135EPromoterpTetAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-D1135E
Plasmid#154924PurposeaTc inducible Cas9HF1 with D1135E mutationDepositorInsertCas9HF1-D1135E
UseCRISPR and Synthetic BiologyTagsssrAExpressionBacterialMutationN497A/R661A/Q695A/Q926A/D1135E and stop codon on …PromoterpTetAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF-lacZ
Plasmid#153036PurposeFor CRISPR-Cas12a genome editing in E. coli for the insertion of large DNA fragments at the lacZ locus. Contains a constitutively expressed CRISPR array targeting the lacZ gene . No cargo DNA.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF-ahpC-rfp
Plasmid#153035PurposeFor CRISPR-Cas12a genome editing in E. coli. Contains a constituitively expressed CRISPR array targeting the ahpC gene in E. coli and donor DNA to insert an rfp translational fusion in the ahpC gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTF-lacZ-rfp
Plasmid#153037PurposeCRISPR-Cas12a genome editing in E. coli. Contains a constitutively CRISPR array targeting the lacZ gene in E. coli genome and donor DNA to insert an constitutively expressed rfp reporter gene.DepositorInsertCRISPR array
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbS8c-ddcpf1-rfp
Plasmid#153038PurposeFor CRISPRi. Arabinose-inducible ddcpf1 gene with CRISPR array targeting the mrfp reporter gene.DepositorInsertAscpf1
ExpressionBacterialMutationE993AAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbS8c-ddcpf1-Δ
Plasmid#153039PurposeFor CRISPRi. Arabinose-inducible ddcpf1 gene with CRISPR array lacking a gene-specific spacer.DepositorInsertAscpf1
ExpressionBacterialMutationE993AAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
BicC.Ca9.R
Plasmid#168295PurposeExpresses Cas9 in Drosophila late germline cellsDepositorInsertBicC.Cas9-T2A-eGFP-p10
UseCRISPRExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRCT
Plasmid#60621PurposePlasmid encoding iCas9, tracrRNA and crRNAsDepositorInsertsiCas9
tracrRNA
UseCRISPRTagsFLAG and SV40 NLSExpressionYeastMutationchanged Aspartate 147 to Tyrosine, Proline 411 to…PromoterRPR1p and TEF1pAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-mB2M
Plasmid#154091PurposeSelf-Cutting and Integrating CRISPR backbone targeting murine B2MDepositorInsertsgRNA and BAIT targeting murine B2M locus
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Decoy
Plasmid#80324PurposeEncodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondiiDepositorInsertDecoy sgRNA
UseCRISPRPromoterU6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCIPpay-BFP reporter
Plasmid#154096PurposeSelf-Cutting and Integrating Payload CRISPR backbone with BFP reporterDepositorInsertP2A-tagBFP
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hTRAC
Plasmid#154094PurposeSelf-Cutting and Integrating CRISPR backbone targeting human TCR-alpha common chainDepositorInsertsgRNA and BAIT targeting human TRAC locus
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL0284 (pQCascade_entry)
Plasmid#130635PurposeExpresses V. cholerae CAST TniQ, Cas8, Cas7, and Cas6 from one T7 promoter, and a CRISPR RNA from a second T7 promoter. The CRISPR array contains two BsaI sites for spacer cloning.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, CRISPR(entry)
UseCRISPR; TransposonExpressionBacterialPromoterT7Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST_116_LVL2 cam
Plasmid#179332PurposeNT-CRISPR plasmid for a single gRNA.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT3TS nErCas12an
Plasmid#132642PurposeUsed for in vitro transcription of dual NLS ErCas12a mRNADepositorInsertErCas12a
UseCRISPR; In vitro transcriptionTagsSV40 NLSPromoterT3Available SinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPN461
Plasmid#137877PurposePiggyBac vector for expression of 1x gRNA targeting POGZ for CRISPRi; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN460
Plasmid#137878PurposePiggyBac vector for expression of 1x gRNA targeting POGZ for CRISPRa;mRFP-T2A-BlasticidinRDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN455
Plasmid#137872PurposeExpression of gRNA targeting POGZ for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN447
Plasmid#137871PurposeExpression of gRNA targeting POGZ for CRISPRi; U6 promoterDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262-ABE8e
Plasmid#161523PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE8e mediated A-G base editingDepositorInsertABE8e-zSpCas9(D10A)
UseCRISPR; Gateway compatible abe8e-zspcas9(d10a) en…ExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only