We narrowed to 13,996 results for: eng
-
Plasmid#162685PurposepET-21b(+) based plasmid for expression of MHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), codon optimized for expression in E. coli K12, with C-terminal His tag, incorporating two point mutations, G489C and S530C, to introduce a 6th disulfide bond (from PETase).DepositorInsertMHETase from Ideonella sakaiensis 201-F6 (Genbank GAP38911.1), with mutations to introduce a 6th disulfide bond from PETase
TagsHisExpressionBacterialMutationG489C, S530C; codon optimized for E. coli K12PromoterT7/lacAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL-c2X-ORF24-NTD
Plasmid#138465PurposeExpresses MBP-tagged ORF24-NTD in bacteriaDepositorInsertORF24 (ORF24 KSHV (HHV-8))
TagsMBPExpressionBacterialMutationAmino acids 1-201PromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297AAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-191084-gp160
Plasmid#123234PurposeMammalian expression plasmid for Env from the 191084 B7-19 HIV-1 isolateDepositorInsertHIV-1 (191084 B7-19) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD14
Plasmid#112822PurposepSMF2 with 14 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
AAEL007584-Cas9
Plasmid#100706PurposeThe promoter of AAEL007584 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL007584-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL007584 and Opie2Available SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSN25
Plasmid#100110Purposeexpresses a chimeric SOX2-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRG1BD-PGK-Puro-IRES-GFP
Plasmid#75121PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRG1 bromodomainDepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BET-PGK-Puro-IRES-GFP
Plasmid#75120PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the first bromodomain of BRD4DepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BRD9_BRD1BD-PGK-Puro-IRES-GFP
Plasmid#75119PurposeRetroviral expression plasmid encoding a human BRD9 bromodomain-swap mutant containing the BRD1 bromodomainDepositorAvailable SinceMay 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pES005 (pTet-qacR wt/pQacA-deGFP)
Plasmid#69034Purposereporter with wild-type qacR on single plasmidDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
FUW-M2-PPP1R12C S452A
Plasmid#31679DepositorInsertProtein Phosphatase 1 Regulatory Subunit 12C S452A (PPP1R12C Human)
UseLentiviralTagsM2ExpressionMammalianMutationchanged Serine 452 to AlanineAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
PTRF/Cavin1_L (OZ513)
Plasmid#27188DepositorInsertZinc finger array targeting PTRF/Cavin1 (cavin1b Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJL NarL YdfI Flag
Plasmid#225650PurposeExpresses NarL with a mutated DNA binding domain (YdfI). For use with NarX chimeras and reporter plasmids from this study.DepositorInsertNarL-YdfI (narL Synthetic)
UseCell free expressionTagsFLAGExpressionBacterialMutationNarL with native DNA-binding domain replaced with…PromoterT7Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE-MyoD-P2A-miRFP703_PGK-Puro
Plasmid#216666PurposeExpresses tTa-inducible MyoD and miRFP703, with puromycin resistanceDepositorInsertsUseLentiviralAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-Ef1a-RPS27A-UTR-PP7-WPRE
Plasmid#198339PurposePB plasmid expressing RPS27A with its 3'UTR tagged to PP7 stem loopsDepositorInsertRPS27A-3'UTR-PP7 stem loops x24
UsePiggybacTagsPP7 stem loopsExpressionMammalianPromoterEf1aAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-PAL1C
Plasmid#196685PurposeRep/Cap plasmid for the production of PAL1C, an AAV capsid with CNS tropism in macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationPTQGTLR insert between amino acids 588 and 589 of…Promoterp41Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-Ubc9-K14R
Plasmid#185759PurposeBacterial expression of His6-Ubc9-K14RDepositorInsertSUMO-conjugating enzyme UBC9 (UBE2I Human)
TagsThrombin-cleavable His6-tagExpressionBacterialMutationK14RPromoterT7Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only