We narrowed to 1,546 results for: Green Fluorescent Protein
-
Plasmid#25445DepositorInsertSec13-Green Fluorescent Protein
ExpressionYeastAvailable SinceJune 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUpstream2Lox
Plasmid#164573PurposeIntegration of 2 LoxN sites in the genome of P. bergheiDepositorInsertsUseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRVdG-EGFP-N-P-M-nucBFP-SynPhRFP-L
Plasmid#52478PurposeExpresses EGFP, nuclear mTagBFP, and Synaptophysin-TagRFP-TDepositorInsertsEGFP
nuclear mTagBFP
Synaptophysin-TagRFP-T
UseRabies virusTagsTagRFP-TExpressionMammalianPromoterCMVAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3
Plasmid#65451PurposepILGFP3 was designed to test the promoter activity using the yeast enhanced green fluorescent protein (yEGFP) as reporter.DepositorTypeEmpty backboneTagsyEGFP reporterExpressionYeastAvailable SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pITGFP3
Plasmid#65452PurposepITGFP3 was designed to test the promoter activity using the destabilized yeast enhanced green fluorescent protein (yEGFP-CLN2PEST) as reporter.DepositorTypeEmpty backboneTagsyEGFP-CLN2PEST reporterExpressionYeastAvailable SinceJune 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pWS033
Plasmid#123056PurposeGreen fluorescent proteinDepositorInsertsfGFP [3]
ExpressionYeastAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-X3
Plasmid#115568PurposeSynthetic acetylation substrate consisting of GFP fusion with 3 repeats of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastMutationThree repeats of the Gcn5 consensus motif are tag…PromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 EGFP-Rab7A
Plasmid#226184PurposeRab7A fused to the enhanced green fluorescent protein N-ter under control of a weak L30 promoter.DepositorAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pJBL3986
Plasmid#204132PurposeThermotoga petrophila (T. pe) fluoride riboswitch, wild typeDepositorInsertT. pe fluoride riboswitch sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJBL811
Plasmid#204135PurposeLow-copy constitutively expressed sfGFP for E. coliDepositorInsertsfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpyA-GFP
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP222-AAV-CMV-GFP-pA
Plasmid#62916PurposeAAV vector backbone designed to express GFP from a CMV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoterCMVAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP220-AAV-0.5Synapsin-GFP-pA
Plasmid#62920PurposeAAV vector backbone designed to express GFP from a 0.5Synapsin promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter0.5synapsinAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP219-AAV-1.1Synapsin-GFP-pA
Plasmid#62921PurposeAAV vector backbone designed to express GFP from a 1.1Synapsin promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter1.1SynapsinAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP214-Lenti-0.5Synapsin P-GFP- WPRE-pA
Plasmid#62929PurposepLenti vector backbone designed to express GFP from a 0.5Synapsin promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter0.5synapsin and 1.3αCaMKIIAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP215-Lenti-0.4CaMKIIa P-GFP-WPRE-pA
Plasmid#62927PurposepLenti vector backbone designed to express GFP from a 0.4CaMKIIa promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter0.4αCaMKII and 1.3αCaMKIIAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-sfGFP-pA-FRT-Amp-FRT
Plasmid#176620Purposefor generating PCR templates with sfGFP and Amp for BAC recombinationDepositorInsertsuper folder green fluorescent protein with FRT-flanked ampicillin cassette
UseUnspecifiedMutationH217R - please see dep. commentsAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
Plasmid#91802PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-X2
Plasmid#115567PurposeGFP tethered to two repeats of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastMutationTwo repeats of the Gcn5 consensus motif are tagge…PromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X1
Plasmid#115566PurposeGFP tethered to a single repeat of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastMutationSingle Gcn5 consensus motif repeat tethered to C-…PromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Iron Insensitive Control Construct 2
Plasmid#243007PurposeIron Insensitive Control Construct under the same expression promoter used in IronFistDepositorInsertsmNeonGreen
T2A
mCherry
UseGatewayExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-CAG-GFP-EnvA(N2c)
Plasmid#194353PurposeLentivirus expressing eGFP and (EnvA-N2c Rabies Glycoprotein) fusion protein. Used to package EnvA pseudotyped G-deleted Rabies of CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
EnvA-CVS-N2c Rabies Glycoprotein
UseLentiviralAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterExpressionYeastPromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
MutationIncludes full 819 bp coding sequence of URA3, 435…Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)IRES GFP
Plasmid#51406PurposeExpresses GFP from internal ribosome entry sequence, cloning componentDepositorInsertIRES GFP
ExpressionMammalianPromoterCMVAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDOC-K-glmS-GFPrev
Plasmid#158060PurposeDonor plasmid for insertion of eGFP and the constitutive acpP promoter into the S. Typhimurium chromosome. GFP is in the reverse orientation relative to the kanamycin resistance selectable markerDepositorInsertGreen Fluorescent Protein optimised for excitation with UV light
UseSynthetic BiologyExpressionBacterialPromoteracpPAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM6-Amp-T7-roGFP
Plasmid#202464PurposeExpresses redox sensitive GFP (roGFP) with T7 inductionDepositorInsertreduction-oxidation sensitive green fluorescent protein
Tags6X-HisExpressionBacterialPromoterT7Available SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmEGFP-N1
Plasmid#217486PurposeExpression of monomeric Enhanced Green Fluorescent ProteinDepositorInsertmEGFP
ExpressionMammalianPromoterCMVAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
TagsN-terminal His6 tagExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-EGFP
Plasmid#114213PurposeAAV vector (control) that targets expression of EGFP to neuronsDepositorInsertEnhanced Green Fluorescent Protein
UseAAV and Mouse TargetingTagsNoneExpressionMammalianMutationNonePromoterhuman synapsin (hSyn)Available SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG/GFP
Plasmid#139980Purposeexpresses GFP under the promoter of CAG. Transgene flanked by AAV2 ITRDepositorInsertGreen fluorescent protein
UseAAVPromoterCAGAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-GFP-W
Plasmid#196046Purposelentiviral expression of the green fluorescent protein driven by cytomegalovirus virus promoterDepositorTypeEmpty backboneUseLentiviralTagseGFPPromoterCMVAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pReporter_8
Plasmid#60568PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_8
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-mMALAT1_3' WT Sense
Plasmid#46834PurposeExpress cGFP transcript ending in the wildtype MALAT1 triple helixDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pReporter_3
Plasmid#60564PurposeA reporter plasmid containing the attB and attP sites flanking a green fluorescent protein reporter gene (gfp).DepositorInsertReporter_3
ExpressionBacterialPromoterBBa_J23119Available SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only