We narrowed to 3,402 results for: aaas
-
Plasmid#90858Purpose3rd generation lentiviral gRNA plasmid targeting human PSMD14DepositorInsertPSMD14 (Guide Designation E5.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_RNF138_G1
Plasmid#127120DepositorInsertgRNA RNF138 (RNF138 Human)
UseCRISPRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
CBX1 A3.5 gRNA
Plasmid#90566Purpose3rd generation lentiviral gRNA plasmid targeting human CBX1DepositorInsertCBX1 (Guide Designation A3.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM BRD7 sh2
Plasmid#41928DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-30kb-DSF
Plasmid#227486Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circZNF652_2
Plasmid#215220PurposeSupression of shcircZNF652(4,RI,5)_2 expressionDepositorInsertcircZNF652 shRNA 2 (ZNF652 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circZNF652_1
Plasmid#215221PurposeSupression of shcircZNF652(4,RI,5)_1 expressionDepositorInsertcircZNF652 shRNA 1 (ZNF652 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_ZNF652_1
Plasmid#215202PurposeSupression of shZNF652 expressionDepositorInsertZNF652 shRNA 1 (ZNF652 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
VirTREX2-HLDel-1_NbSTM-5'UTR
Plasmid#231148PurposeT-DNA encoding TRV2 with TREX2 and mobile gRNA targeting NbSTM-5?UTRDepositorInsertTREX2 and mobile gRNA targeting NbSTM-5?UTR
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-hL1-gRNA2-EGFP
Plasmid#226003PurposeCRISPRi-KD of human LINE1DepositorInsertsgRNA targeting human L1HS
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_131
Plasmid#216095PurposeCas12a [EnAs] CRISPRa targeting CD97, CD4, CD26, CD274, positive controlDepositorInsertCD97, CD4, CD26, CD274 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA1
Plasmid#189746PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMERVK10c_1
Plasmid#185020PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK10c
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-mHdac1-R2
Plasmid#122308PurposeExpresses sgRNA targeting mouse Hdac1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Hdac1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-SAC1-HLx6
Plasmid#108135PurposeRecruitable SAC1 with extended linkerDepositorInsertmCherry:FKBP1A(3-108):[GGSA]4GG:SACM1L(1-520):[EAAAR]6:SACM1L(521-587) (SACM1L Human)
ExpressionMammalianMutationSACM1L(1-520):[EAAAR]6:SACM1L(521-587)PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-SAC1-HLx4
Plasmid#108134PurposeRecruitable SAC1 with extended linkerDepositorInsertmCherry:FKBP1A(3-108):[GGSA]4GG::SACM1L(1-520):[EAAAR]4:SACM1L(521-587) (SACM1L Human)
ExpressionMammalianMutationSACM1L(1-520):[EAAAR]4:SACM1L(521-587)PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
UNG D11.3 gRNA
Plasmid#90936Purpose3rd generation lentiviral gRNA plasmid targeting human UNGDepositorInsertUNG (Guide Designation D11.3)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PTTG1 A9.4 gRNA
Plasmid#90862Purpose3rd generation lentiviral gRNA plasmid targeting human PTTG1DepositorInsertPTTG1 (Guide Designation A9.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
POC1A F11.2 gRNA
Plasmid#90838Purpose3rd generation lentiviral gRNA plasmid targeting human POC1ADepositorInsertPOC1A (Guide Designation F11.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MCM10 B10.6 gRNA
Plasmid#90757Purpose3rd generation lentiviral gRNA plasmid targeting human MCM10DepositorInsertMCM10 (Guide Designation B10.6)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
SPAG5 G7.2 gRNA
Plasmid#90900Purpose3rd generation lentiviral gRNA plasmid targeting human SPAG5DepositorInsertSPAG5 (Guide Designation G7.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CFDP1 C12.4 gRNA
Plasmid#90625Purpose3rd generation lentiviral gRNA plasmid targeting human CFDP1DepositorInsertCFDP1 (Guide Designation C12.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
PAFAH1B1 G10.3 gRNA
Plasmid#90823Purpose3rd generation lentiviral gRNA plasmid targeting human PAFAH1B1DepositorInsertPAFAH1B1 (Guide Designation G10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
ECT2 B2.4 gRNA
Plasmid#90675Purpose3rd generation lentiviral gRNA plasmid targeting human ECT2DepositorInsertECT2 (Guide Designation B2.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
ZW10 H9.3 gRNA
Plasmid#90942Purpose3rd generation lentiviral gRNA plasmid targeting human ZW10DepositorInsertZW10 (Guide Designation H9.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
TOPBP1 G1.4 gRNA
Plasmid#90916Purpose3rd generation lentiviral gRNA plasmid targeting human TOPBP1DepositorInsertTOPBP1 (Guide Designation G1.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PTTG1 G9.1 gRNA
Plasmid#90860Purpose3rd generation lentiviral gRNA plasmid targeting human PTTG1DepositorInsertPTTG1 (Guide Designation G9.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
DSN1 C12.1 gRNA
Plasmid#90657Purpose3rd generation lentiviral gRNA plasmid targeting human DSN1DepositorInsertDSN1 (Guide Designation C12.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-RPA194
Plasmid#247352PurposeExpresses SpCas9 and a sgRNA targeting the human RPA194 loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NBRE3
Plasmid#208254PurposepGL3 promoter luciferase reporter vector containing 3 copies of the NBRE DNA response element (5′-GAGTTTTAAAAGGTCATGCTCAATT TGTC-3′) used for luciferase reporter assays in mammalian cellsDepositorInsert3X NBRE-LUC
ExpressionMammalianPromoterSV40 early promoterAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA1
Plasmid#201634PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
SPHK1 gRNA (BRDN0001148403)
Plasmid#76815Purpose3rd generation lentiviral gRNA plasmid targeting human SPHK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro_shDDX58_230212
Plasmid#167293PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene DDX58 (coding for RLR sensor RIG-I). Contains a puro resistance cassette.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7558 pHR (hU6-crB2M-EFS-PuroR-WPRE)
Plasmid#214881PurposeLentiviral vector encoding RfxCas13d targeting B2M guideDepositorInserthU6-crB2M-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNUAK1
Plasmid#138692PurposeExpresses a human NUAK1-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Chr8q_Centromere-Targeting_gRNA
Plasmid#195128PurposegRNA targeting centromere-proximal location on Chromosome 8q in a third generation Cas9 backbone with GFPDepositorInsertChr8q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only