We narrowed to 16,981 results for: form
-
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_huCAD_ICADL (TevS)
Plasmid#100098Purposedual expression of human CAD and ICAD. The two caspase cleavage sites in ICAD were mutated to TEVP cleavable sequencesDepositorExpressionBacterialMutationtwo caspase cleavage sites (DETD-117 and DAVD-224…PromoterT7Available SinceJan. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-mCherry-G12V-KRAS-IRES-Blast
Plasmid#153336PurposeLentiviral vector plasmid for integration and constitutive expression of mCherry fused to oncogenic G12V-KRAS in mammalian cellsDepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha11-RLuc8
Plasmid#140983PurposeEncodes a G alpha subunit (GNA11) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha11-RLuc8 (GNA11 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-Neurofascin (extracellular) [A12/18R]
Plasmid#177438PurposeMammalian Expression Plasmid of anti-Pan-Neurofascin (extracellular) (Rat). Derived from hybridoma A12/18.DepositorInsertanti-Pan-Neurofascin (extracellular) (Rattus norvegicus) recombinant mouse monoclonal antibody (Nfasc Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTG1*-thymosinB-8His
Plasmid#111147PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.DepositorInsertactin gamma 1 (ACTG1 Human)
UsePichia pastoris integration vectorTagsThymosin beta and a His-tagExpressionYeastMutationcodon-optimised for expression in Pichia pastorisPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha12-RLuc8
Plasmid#140985PurposeEncodes a G alpha subunit (GNA12) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha12-RLuc8 (GNA12 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaz-RLuc8
Plasmid#140978PurposeEncodes a G alpha subunit (GNAZ) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaz-Rluc8 (GNAZ Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-HAPLN1
Plasmid#200777PurposeExpresses full-length mouse HAPLN1 fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas ServiceAAV8InsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPPromoterSynapsinAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-Nav1.2 Na+ channel [K69/3R]
Plasmid#206520PurposeMammalian Expression Plasmid of anti-Nav1.2 Na+ channel (Rat). Derived from hybridoma K69/3.DepositorInsertanti-Nav1.2 Na+ channel (Rattus norvegicus) recombinant Mouse monoclonal antibody (Scn2a Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltraHot-mCherry-DHX36-iso1-WT
Plasmid#206964Purposeexpressing the protein DHX36 fused to mCherry in human cellsDepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphasL-RLuc8
Plasmid#140981PurposeEncodes a G alpha subunit (GNAS1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphasL-RLuc8 (GNAS Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRP4 (extracellular) scFv [N207/27]
Plasmid#190537PurposeMammalian Expression of LRP4 (extracellular) scFV. Derived from hybridoma N207/27.DepositorInsertLRP4 (extracellular) (Mus musculus) recombinant scFV (Lrp4 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Bral1 scFv [N364/42 scFv]
Plasmid#219494PurposeMammalian Expression Plasmid of anti-Bral1 (Mouse) scFv. Derived from hybridoma N364/42.DepositorInsertAnti-Bral1 (Mus musculus) recombinant mouse scFv. (Hapln2 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Iduna/RNF146 [N201/35R-2b]
Plasmid#206663PurposeMammalian Expression Plasmid of anti-Iduna/RNF146 (Mouse). Derived from hybridoma N201/35-2b.DepositorInsertanti-Iduna/RNF146 (Mus musculus) recombinant Mouse monoclonal antibody (Rnf146 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai3-RLuc8
Plasmid#140975PurposeEncodes a G alpha subunit (GNAI3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai3-RLuc8 (GNAI3 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphai2-RLuc8
Plasmid#140974PurposeEncodes a G alpha subunit (GNAI2) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphai2-Rluc8 (GNAI2 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-SynDIG4/Prrt1 [L102/45R]
Plasmid#177450PurposeMammalian Expression Plasmid of anti-SynDIG4/Prrt1 (Rat). Derived from hybridoma L102/45.DepositorInsertanti-SynDIG4/Prrt1 (Rattus norvegicus) recombinant mouse monoclonal antibody (Prrt1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha13-RLuc8
Plasmid#140986PurposeEncodes a G alpha subunit (GNA13) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha13-RLuc8 (GNA13 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Anti-TrpM7 [N74/25R]
Plasmid#177569PurposeMammalian Expression Plasmid of anti-TrpM7 (Mouse). Derived from hybridoma N74/25.DepositorInsertanti-TrpM7 (Mus musculus) recombinant mouse monoclonal antibody (Trpm7 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Kir2.1 K+ channel scFv [N112B/14]
Plasmid#199423PurposeMammalian expression of Kir2.1 K+ channel scFv. Derived from hybridoma N112B/14.DepositorInsertrecombinant mouse scFv targetingKir2.1 K+ channel (Rat) (Kcnj2 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-∆Hapln1
Plasmid#200778PurposeExpresses mouse HAPLN1 mutant lacking the lectican binding domain and fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas ServiceAAV8InsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPMutationdeleted lectican binding domain (aminoacids 40-15…PromoterSynapsinAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-VGlut3 [N34/34R-2b]
Plasmid#219476PurposeMammalian Expression Plasmid of anti-VGlut3 neurotransmitter transporter (Rat) subclass-switched IgG2b R-mAb. Derived from hybridoma N34/34.DepositorInsertAnti-VGlut3 neurotransmitter transporter (Rattus norvegicus) recombinant mouse monoclonal antibody. (Slc17a8 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4/KCNQ4 K+ channel scFv [N43/6]
Plasmid#206733PurposeMammalian Expression of Kv7.4/KCNQ4 K+ channel scFV. Derived from hybridoma N43/6 scFv.DepositorInsertKv7.4/KCNQ4 K+ channel (Homo sapiens) recombinant scFV (KCNQ4 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only