We narrowed to 19,814 results for: INO
-
Plasmid#21177DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationPoint mutation at nucleotide 6163 (numbering acco…Available SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 asyn S87A
Plasmid#36058DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SSA TLR (CCR5 TALEN Sce Spacer)
Plasmid#46941PurposeCodes for the SSA-TLR with the target site for the CCR5 TALEN with the spacer region corresponding to I-Sce I in a lentiviral backboneDepositorInserts5' iRFP arm
eGFP with TALEN TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded TALEN TS from 163-218, truncated 25 amin…PromoterSFFVAvailable SinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_mP_SV40
Plasmid#99310PurposeLuciferase validation vector with SV40 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertSV40 enhancer
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hDDB2-R273H-V5
Plasmid#167469Purposeectopic expression of hDDB2 in mammalian cellsDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.2 (20-362)
Plasmid#177845PurposeBacterial Expression of SnRK2.2DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT5T_hp53_ST_CR2
Plasmid#34923DepositorInsertp53 DNA-binding (Res 94-358, deletion 293-321) (TP53 Human)
ExpressionBacterialMutationC135V, C141V, W146Y, C182S, V203A, R209P, C229Y, …PromoterT7Available SinceFeb. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
His6-SMT3-SopB
Plasmid#183676PurposeRecombinant Salmonella Typhimurium SopBDepositorInsertsopB (sopB Salmonella enterica serovar Typhimurium, Budding Yeast)
TagsHis6-S. cerevisiae SMT3(2-101)ExpressionBacterialPromoterT7Available SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Donor/Reporter-COL4A5
Plasmid#130280PurposeCOL4A5 mutation-specific sgRNA under the control of U6 promoter; mCherry-sgRNA target-(out of frame)EGFP expression cassette; COL4A5 donor templateDepositorInsertmCherry-eGFP
UseAAVPromoterCMVAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2116
Plasmid#49141PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-c
Plasmid#53070Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
ptdTomato-N1-CMVL-ikk1FL(C179A)-tdTomato
Plasmid#105644PurposeZebrafish Inhibitor of kappa B kinase alpha with mutation at position 179 from cysteine to alanineDepositorInsertCMVL-ikk1FL(C179A)-tdTomato (chuk Zebrafish)
TagstdTomatoExpressionMammalianMutationCMV:ikk1FL(C178A)-tdTomatoAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC/RSV-rat Agt
Plasmid#122104PurposeExpression of angiotensinogenDepositorAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc AspCas12a
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag4A-MMP8 (P78S)
Plasmid#29546DepositorInsertMetalloproteinase protein 8 (MMP8 Human)
TagsFLAGExpressionBacterial and MammalianMutationP78SAvailable SinceJuly 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hDDB2-T338M-V5
Plasmid#167470Purposeectopic expression of hDDB2 in mammalian cellsDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-DICER-Prom Ebox double mut
Plasmid#25854DepositorInsertDICER-Promoter Ebox double mut (DICER1 gene ID 23405, Human)
UseLuciferaseExpressionMammalianAvailable SinceAug. 25, 2010AvailabilityAcademic Institutions and Nonprofits only