We narrowed to 9,470 results for: CAG
-
Plasmid#245876PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCAV035_mCherry_P2A_fsEGFP_GGsite
Plasmid#219807PurposeFluorescent Reporter for MUTYH-Specific Activity; Containing BsaI Recognition Sequence at Frameshifted EGFP; For OG:A Oligo Insertion at Golden Gate (GG) Site at Codon 34DepositorInsertmCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_tnnt2a_cmlc2-nmKate
Plasmid#238309PurposeDrives expression of 3 different gRNAs targeting tnnt2a, and expression of nuclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting tnnt2a
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SQLE_sg2
Plasmid#244872PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SQLE_sg1
Plasmid#244871PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-G132N
Plasmid#236065PurposeSmBit-CHIP expression with G132N substitutionDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBOB-3xFlag-hGpr75-p.Ala110fs
Plasmid#236747PurposeExpress 3xFlag N-terminal tagged human GPR75 p.Ala110fs mutant transiently via transfection or stably via lentivirus-mediated infection in mammalian cells.DepositorInsertGPR75 (GPR75 Human)
UseLentiviralTags3xFlagExpressionMammalianMutationAla110fs, deletion of GCCAGTAAvailable SinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-flag-IARS2-Δ1-48
Plasmid#232341PurposeExpresses human IARS2 with mito-location signal replaced by flag tag in mammalian cells, also carrying synonymous mutations described in Addgene #232340DepositorInsertIARS2 (IARS2 Human)
ExpressionMammalianMutationResidues 1-48 (indicated as Mito-signal in UniPro…PromoterCMVAvailable SinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO1124
Plasmid#235725PurposeExpression of human UVRAG (1-464) fused to human ATG14L BATS (413-492) in mammalian cellsDepositorInsertUVRAG(1-464) fused to ATG14L BATS domain (413-492)
ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pQdCas12a.luxR(mut)-sggfp(B)
Plasmid#236041PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circRNF170_2
Plasmid#215225PurposeSupression of shcircRNF170(2-6)_2 expressionDepositorInsertcircRNF170 shRNA 2 (RNF170 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
shRNA_circRNF170_1
Plasmid#215226PurposeSupression of shcircRNF170(2-6)_1 expressionDepositorInsertcircRNF170 shRNA 1 (RNF170 Human)
UseLentiviralAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only