We narrowed to 17,816 results for: multi
-
Plasmid#51247PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907 mutated to AlaPromoterEF1aAvailable SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRG706_lexO-SbfI_LexA-TF_LEU2MX
Plasmid#154818PurposeInducible expression of SbfI endonuclease in S. cerevisiaeDepositorInsertsSbfI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRG659_lexO-FseI_LexA-TF_LEU2MX
Plasmid#154816PurposeInducible expression of FseI endonuclease in S. cerevisiaeDepositorInsertsFseI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRG714_lexO-AscI_LexA-TF_URA3MX
Plasmid#154822PurposeInducible expression of AscI endonuclease in S. cerevisiaeDepositorInsertsAscI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ8541 PB-PGK-RR12EE345L-C term (406) dLbCpf1-2XNLS-miniVPR-mCherry-pA
Plasmid#140222PurposeConstitutive PGK driven expression of leucine zipper with C terminal dCpf1 (Cas12a) 406-split half fused to miniVPRDepositorInsertzipper with dLbCpf1 (Cas12a) C terminal half (406) fused to miniVPR
TagsmCherryExpressionMammalianMutationD832APromoterPGKAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-CNL-CP
Plasmid#65715PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-CNL-CP)DepositorInsert7xTcf, minCMV, 3xNLS, CNL, hCL1-PEST
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT2-7xTcf-NLS-YNL-CP
Plasmid#65714PurposeTol2-based Wnt signal reporter plasmid (expresses NLS-YNL-CP)DepositorInsert7xTcf, minCMV, 3xNLS, YNL, hCL1-PEST
UseLuciferaseAvailable SinceJan. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUSE-rabbitFc1-IL2ss-VHH(G08)-His-Myc
Plasmid#209857PurposePlasmid coding for a nanobody (termed G08) against FGFR3 (mus musculus) with x6 HisTag, x3 myc, and Fabbit FC gamma 1DepositorInsertsIL2-ss
VHH (G08 variant)
Rabbit Fc Gamma 1
Tagsx3 MycTag and x6 HisTagExpressionMammalianPromoterhEF1-HTLV promoterAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEarleyGate 100RMOA mPing
Plasmid#196137PurposeMeasures mPing transposition in plantsDepositorInsertsPong TPase LA T2A ORF1SC1 ONE
mPing
UseBinaryExpressionPlantMutationTPase NES sequence mutated L418A, L420A; T2A pept…Promoter35S and RPS5aAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-GluK5/Grik5/KA2 kainate receptor [N279B/27R]
Plasmid#149451PurposeMammalian Expression Plasmid of anti-GluK5/Grik5/KA2 kainate receptor (Rat). Derived from hybridoma N279B/27.DepositorInsertanti-GluK5/Grik5/KA2 kainate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody (Grik5 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113698PurposeDox-inducible U6 SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-T2A-BirA*
Plasmid#115652PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassetteDepositorUseAAVTagsBirA* and T2AMutationHomology region 1 and Homology region 2Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCOTS-pyl-GFP(35TAG)
Plasmid#92047PurposeThis is a S. elongatus (PCC7942) cyanobacterial plasmid that encodes the pylRS orthogonal translation system. In addition it encodes for a GFP reporter with TAG mutation at site 35.DepositorInsertsEGFP
Pyrrolysyl tRNA(cua)
Pyrrolysyl tRNA synthetase (methanosarcina mazei)
UseReplicative expression plasmid for cyanobacteria …TagsHistagMutationTyrosine in position 35 of the GFP was mutated f…PromoterLeuP (native S. elongatus promoter), PpsbII, and …Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-NCBD + ACTR
Plasmid#99335PurposeBacterial coexpression of CBP NCBD and NCoA3 binding domainsDepositorExpressionBacterialPromoterT7Available SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFIN-XOPS-tdTOM-MOPS-GFP
Plasmid#44347DepositorInsertsXOPS-tdTOM
MOPS-GFP
UseLentiviralPromoterXenopus Opsin (XOPS) (pos 3131-4495) and mouse op…Available SinceMay 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1Tt
Plasmid#44509DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUpstream2Lox
Plasmid#164573PurposeIntegration of 2 LoxN sites in the genome of P. bergheiDepositorInsertsUseCre/LoxPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only