We narrowed to 17,934 results for: multi
-
Plasmid#188994PurposeA plasmid for dual expression of CRY2-mCh-superPLDx100 (an engineered PLD mutant with 100 times higher activity than the wild-type) and plasma membrane-tagged CIBNDepositorInsertPLD
TagsCAAX, CIBN, CRY2, P2A, and mCherryExpressionMammalianMutationK57R, A59V, K109R, P245A, V264I, G328S, G381V, G4…PromoterCMVAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*- MmH-MH4R
Plasmid#196409PurposeExpress sfGFP with TAG and enzymes for biosynthesizing DOPADepositorInsertsExpressionBacterialAvailable sinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pnCS_SEPT7_SEPT9_i5-TEV-Strep
Plasmid#174502Purposebacterial co-expression of human SEPT7 and of human SEPT9_i5DepositorAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiDP1.3
Plasmid#171096Purposelentiviral construct (3rd generation) for the expression of cell cycle-dependent OsTIR1 fused with mEmerald and Cdt1 (AKA ROLECCS G1) and miniAID-fused mCherry2DepositorInsertOsTIR1-mEmerald-Cdt1-P2A-miniAID-mCherry2
UseLentiviral and Synthetic BiologyTagsEmerald, cdt1, miniAID, mCherry2ExpressionMammalianPromoterCMVAvailable sinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_ABE7.10_St1Cas9_LMD9
Plasmid#136660PurposeExpresses ABE St1Cas9 LMD9 in mammalian cells along with its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
ABE7.10
UseCRISPR and Synthetic BiologyTagsSV40 NLS and hSt1Cas9ExpressionMammalianPromoterCAG and U6Available sinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
UPRT-mCh-Nluc-P2A-neo-UPRT
Plasmid#135015PurposeExpresses mCherry protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum UPRT locusDepositorInsertsmCh-Nluc-P2A-neo
UPRT 5'UTR
UPRT 3'UTR
UseCryptosporidium expressionTagsmCherry and Nluc-neoPromoterCryptosporidium actin and enolaseAvailable sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-Kv4.2 K+ Channel (External) [K57/1R]
Plasmid#128622PurposeMammalian Expression Plasmid of anti-Kv4.2 K+ Channel (External) (Human). Derived from hybridoma K57/1.DepositorInsertanti-Kv4.2 K+ Channel (External) (Human) recombinant mouse monoclonal antibody (KCND2 Mouse)
ExpressionMammalianPromoterDual CMVAvailable sinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_dCas9-2xAM_hIRF-1
Plasmid#92221PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoterDepositorInsertsSp-dCas9-2xAM tag
gRNA targeting human IRF-1 promoter
UseCRISPR and LentiviralTags2xAM tagExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterCBh and U6Available sinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CMV-CAD
Plasmid#73567PurposeSoluble activator of Orai1 channelsDepositorAvailable sinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRJPaph-gusA
Plasmid#67036PurposePlasmid for Paph-gusA integration downstream of B. diazoefficiens (B. japonicum) scoIDepositorInsertsB. diazoefficiens DNA from scoI downstream region (comprising blr1132')
gusA
UseConjugative bacterial vectorAvailable sinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDGE1109
Plasmid#202773PurposeCRISPR-KO with TRE2 exonuclease co-expression in Arabidopsis thalianaDepositorInsertsFAST marker
pRPS5a:TREX2-zCas9_ttriple
ccdB cassette (BsaI-excisable)
UseCRISPRExpressionPlantAvailable sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10714
Plasmid#183959PurposeU6-crKlf4-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Klf4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCMV-IE1:GLuc:bgH
Plasmid#135294PurposeTranscriptional unit for constitutive expression of GLuc in mammalian cellsDepositorInsertCMV:GLuc:bGH
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pONL-C1_H2B
Plasmid#65704PurposeExpresses ONL-H2B in mammalian cellsDepositorInserthistone H2B
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable sinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYNL-C1_H2B
Plasmid#65702PurposeExpresses YNL-H2B in mammalian cellsDepositorInserthistone H2B
UseLuciferaseTagsYNLExpressionMammalianPromoterCMVAvailable sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPBCAG-rtTAM2-2A-SOX17-GR-IH
Plasmid#165079PurposeUbiquitously expresses rtTAM2, dexamethasone-inducible human SOX17, and hygromycin-resistance gene.DepositorInsertsUsePiggybac transpositionTagsGlucocorticoid ReceptorExpressionMammalianAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2xp53_RE
Plasmid#118053PurposeGBPart - Operator/DNA Response element - 2 copies of the p53 DNA binding motifDepositorInsert2 copies of the p53 DNA binding motif
UseSynthetic Biology; Domestication of dna parts for…Available sinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only