-
Plasmid#97307PurposeAAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoterDepositorInserthumanized S. pyogenes Cas9
UseAAV and Mouse TargetingTagsFlagExpressionMammalianMutationPromoterEFSAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Efs_hSpCas9_NLS_FLAG-WPRE
Plasmid#97313PurposeLentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter.DepositorInserthumanized S. pyogenes Cas9
UseLentiviral and Mouse TargetingTagsFlagExpressionMammalianMutationPromoterEFSAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG_NLS-Cas9-XTEN-Ec73RT-NLS_pA_pCMV_BFP_pA
Plasmid#176458PurposeVector for encoding a human codon-optimized SpCas9-XTEN-Ec73RT fusion driven by CAG promoter and tagBFP driven by CMV promoterDepositorInserthumanized S. pyogenes Cas9-XTEN-Ec73RT fusion
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-ACTA2_gRNA1-SpCas9-T2A-GFP
Plasmid#126706Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human ACTA2 locus at the end of the endogenous coding sequenceDepositorInsertACTA2_gRNA1-SpCas9-T2A-GF (ACTA2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
UseTagsExpressionMammalianMutationPromoterHuman U6Available sinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAS9PBKS
Plasmid#68371PurposeCbAkt promoter driven Cas9-2A-GFP (from px458)DepositorInsertCas9
UseTags2A-EGFPExpressionMammalianMutationPromoterCbAktAvailable sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDNR-SpCas9
Plasmid#80425PurposeUsed for in vitro transcription of SpCas9 mRNA.DepositorInsertSpCas9
UseCRISPRTagsnoneExpressionMutationcodon optimized for humanPromoterT7Available sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-SpCas9
Plasmid#130968Purpose3xHA tagged Cas9 from S. pyogenes with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-SpCas9
UseCRISPRTags3x HA, EGFP, and NLSExpressionMammalianMutationPromoterCbhAvailable sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only