We narrowed to 1,704 results for: pyogenes Cas9
-
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
EF1a-TET1-dCas9
Plasmid#235593PurposeTet1CD fused to N-terminus of dCas9DepositorInsertTET1-dCas9 (TET1 Human, SpCas9 is from Streptococcus pyogenes)
UseCRISPRTags3xNLS, TET1 CD, and tagBFPExpressionMammalianMutationPromoterEF1aAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-TET1-dCas9
Plasmid#235599PurposeExpresses Tet1CD-dCas9DepositorInsertTET1-dCas9 (TET1 Human, SpCas9 is from Streptococcus pyogenes)
UseCRISPR and LentiviralTags3xNLS and TET1 CDExpressionMammalianMutationPromoterEF1aAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-G6
Plasmid#73437PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6.DepositorInsertRepressor G6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-C4
Plasmid#73427PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
1098A=TI-pgSIT[sxl,bTub,Hasp70Bb-Cas9]
Plasmid#149426PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel sxl and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[Sxl, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectMutationPromoterAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
Plasmid#42335PurposeA human codon-optimized SpCas9 nickase and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationPromoterAvailable sinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
FUCas9GFP
Plasmid#85555PurposeExpresses Cas9 with green fluorescent reporterDepositorInserthumanised S.pyogenes Cas9
UseCRISPR and LentiviralTagsFlagExpressionMammalianMutationPromoterhUBCAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…PromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUCas9Cherry
Plasmid#70182PurposeExpresses Cas9 with fluorescent Cherry reporterDepositorInserthumanised S.pyogenes cas9
UseCRISPR and LentiviralTags3xFLAGExpressionMammalianMutationPromoterhUbCAvailable sinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Efs_hSpCas9_NLS_FLAG-SV40
Plasmid#97307PurposeAAV vector for encoding a human codon-optimized SpCas9 driven by EFs promoterDepositorInserthumanized S. pyogenes Cas9
UseAAV and Mouse TargetingTagsFlagExpressionMammalianMutationPromoterEFSAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Efs_hSpCas9_NLS_FLAG-WPRE
Plasmid#97313PurposeLentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter.DepositorInserthumanized S. pyogenes Cas9
UseLentiviral and Mouse TargetingTagsFlagExpressionMammalianMutationPromoterEFSAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only