We narrowed to 19,814 results for: INO
-
Plasmid#224443PurposeRep/Cap plasmid for the production of MyoAAV 3B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP
Plasmid#137163PurposeIntersectional viral expression of ChR2-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-ClACE2 (Dog)
Plasmid#158083PurposeExpresses dog ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_YY1_WT
Plasmid#82171PurposeGateway Donor vector containing YY1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2-mCherry
Plasmid#137144PurposeIntersectional viral expression of ChR2-mCherry in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 variant click editor (CE1) - pCMV-T7-PCV2-nSaCas9-EcKlenow (MLE194)
Plasmid#217801PurposeVariant CE1 construct with SaCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSaCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSaCas9(N580A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1.shCDK8
Plasmid#19760DepositorAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-MSMV-nCas9-EcKlenow (JO661)
Plasmid#208947PurposeA variant CE1 construct with MSMV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertMSMV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-RnACE2 (Rat)
Plasmid#158086PurposeExpresses rat ACE2 in mammalian cellsDepositorAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOT_3 - lenti-EFS-FMC6.3-28z-2A-puro-2A-LTBR
Plasmid#181972PurposeExpresses anti-CD19 CAR (with CD28 signaling domain) linked to puromycin resistance via P2A and to human LTBR via T2A for lentiviral delivery.DepositorInsertFMC6.3-28z CAR; LTBR (LTBR Human, Synthetic)
UseLentiviralAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RNF4ca-P2A-BLAST
Plasmid#208047PurposeEnables constitutive expression of N-terminal BirAopt-fused RNF4ca (catalytically inactive RING mutant); to perform bioE3; selection with blasticidinDepositorInsertRNF4 (RNF4 Human)
UseLentiviralTagsBirAoptMutationCys>Ala mutations in conserved RING domainPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CCND1
Plasmid#172648PurposeExpresses 2xFLAG-2xSTREP-tagged cyclin D1 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-ChR2(ET/TC)-EYFP
Plasmid#137139PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-NpHR3.3-EYFP
Plasmid#137153PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationW179FPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-Arch3.3-EYFP
Plasmid#137149PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-Arch3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
alpha actinin delta ABD-GFP
Plasmid#66935PurposeMammalian expression of alpha actinin with actin binding domain (amino acids 30–253) deletedDepositorInsertAlpha-actinin 1 (ACTN1 Human)
TagsGFPExpressionMammalianMutationactin binding domain (amino acids 30–253) is dele…PromoterCMVAvailable SinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pscALPSpuro-FcACE2 (Cat)
Plasmid#158082PurposeExpresses cat ACE2 in mammalian cellsDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-PLOD2_PGK-GpNLuc
Plasmid#136457PurposeExpresses Tet/Dox-inducible human PLOD2 in mammalian cells.DepositorInsertTRE3G::PLOD2-T2A-Hygromycin (PLOD2 Human)
UseLuciferase and RetroviralExpressionMammalianPromoterTRE3GAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pvalb-2A-Flpo Flp-in replacement vector
Plasmid#61572PurposeRecombinase-mediated cassette exchange in ES cells to insert the Flpo recombinase gene at the mouse Pvalb gene stop codonDepositorInsertPvalb-2A-Flpo
UseRecombinase-mediated cassette exchange using flp …Available SinceFeb. 9, 2015AvailabilityAcademic Institutions and Nonprofits only