We narrowed to 14,065 results for: crispr grnas
-
Plasmid#118414PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting AAVS1 locusDepositorAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLdCN2
Plasmid#125186PurposeExpresses Streptococcus pyogenes Cas9 (SpCas9) and two gRNAs in LeishmaniaDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCC001
Plasmid#124451PurposeMulti-species CRISPR/Cas9 coexpression system, optimized for Golden Gate cloning of gRNA targetsDepositorInsertHH-BsaI
ExpressionYeastMutationgRNA expression cassette from pUDP002 modified to…PromoterTDH3 promoter from S.cerevisiae (already present …Available SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OCT4
Plasmid#69537PurposeEpisomal plasmid encoding 5 gRNAS targeting human OCT4 promoterDepositorInsert5 concatenated gRNA transcriptional cassettes targeting OCT4
UseCRISPRAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-TUBB
Plasmid#66942PurposeCRISPaint target selector TUBBDepositorInsertgRNA TUBB
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g4 + Cas9
Plasmid#153014PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgRosa26
Plasmid#159914PurposeMutagenesis of Rosa26 with SauCas9DepositorInsertRosa26 gRNA (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
EKv413(Gold Cas-guide insert4 2 gene version)
Plasmid#248342PurposegRNA insert vector for Golden Gate Assembly, 2 gene or 4 gRNAs versionDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv414(Gold Cas-guide insert6 3 gene version)
Plasmid#248343PurposegRNA insert vector for Golden Gate Assembly, 3 gene or 6 gRNAs versionDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
JD633
Plasmid#160393PurposeCRISPR-Cas9 vector including GRF4-GIF1. For wheat and other monocots CRISPR experiments. Includes two AarI sites for gRNA cloningDepositorInsertsZmUbi::wheat GRF4-GIF1 chimera
ZmUbi:TaCas9 + TaU6:gRNA
UseBinary vectorAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDR348 FANCF
Plasmid#47510Purposehuman gRNA expression vector targeting FANCFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 T2 CRIPR in pX330
Plasmid#72833PurposeCRISPR/Cas to target the AAVS1 locus in human cellsDepositorInsertCas9 and gRNA for targeting the AAVS1 locus in human cells
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only