We narrowed to 13,072 results for: BASE;
-
Plasmid#100085PurposedCas9 fused to two FOG1 peptide [aa 1-45] , one at the N-terminus and one at the C-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertFOG1(aa 1-45) (ZFPM1 Human)
UseCRISPRTags3XFLag-NLS-FOG1-dCas9-FOG1-NLSExpressionMammalianPromoterCMVAvailable SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd
Plasmid#118278PurposeExpresses bPAC(WT)-mCherry under a minimal CamKII PromoterDepositorInsertbPAC(WT)
UseAAVTagsmCherry and mycPromoterCamKIIAvailable SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor
Plasmid#97317PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb.DepositorInsertActb HR donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-XRCC1-EGFP-Hygro
Plasmid#176062PurposeEGFP fused to the C-terminus of XRCC1 & a hygromycin resistance cassetteDepositorInsertX-ray repair cross complementing 1 (XRCC1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Efs_hSpCas9_NLS_FLAG-WPRE
Plasmid#97313PurposeLentiviral vector for encoding a human codon-optimized SpCas9 driven by EFs promoter.DepositorInserthumanized S. pyogenes Cas9
UseLentiviral and Mouse TargetingTagsFlagExpressionMammalianPromoterEFSAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E
Plasmid#224580PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 in mammalian cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 P35S:MS2:VPR:Tnos - P35S:dCas9:EDLL:Tnos (GB2085)
Plasmid#160645PurposeModule for the expression of Ms2 protein fused to VPR and dCas9 fused to EDLLDepositorInsertP35s-Ms2:VPR-Tnos-35s-dCas9:EDLL-Tnos
UseSynthetic BiologyExpressionPlantMutationBsmBI sites removedPromoter35S x2Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp4
Plasmid#156474PurposeBacterial expression of Sars-CoV2 Nsp4 protein with His-tag and GST-tagDepositorInsertNsp4 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Progerin C661S
Plasmid#118711PurposeLentiviral TET-ON inducible GFP-Progerin C661S (Farnesylation mutant)DepositorInsertGFP-Progerin C661S (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianMutationC661S farnesylation mutantPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
single polypeptide FPX biosensor for caspase-8
Plasmid#60884PurposeFPX biosensor for caspase-8DepositorInsertsingle polypeptide FPX biosensor for caspase-8
TagsHindIII site and NES sequence LALKLAGLDIGSExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H170
Plasmid#170352PurposemTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp16
Plasmid#156482PurposeBacterial expression of Sars-CoV2 Nsp16 protein with His-tag and GST-tagDepositorInsertNsp16 (ORF1ab Severe acute respiratory syndrome coronavirus 2, Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamKII-GFP-P2A-bReaches-minWPRE
Plasmid#118276PurposeExpresses EGFP and bReaChES under a minimal CamKII PromoterDepositorInsertsEGFP
bReaCHES
UseAAVTagsP2APromoterCamK IIAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV_Nanog HMEJ donor
Plasmid#97321PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Nanog. AAV backbone.DepositorInsertNanog HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FAPdL5-POST-T2A-dTomato.WPRE.bGH
Plasmid#105981PurposeThis AAV plasmid constitutively expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInserthSyn-Igkappa-myc-FAPdL5-POST-T2A-dTomato-WPRE-bGH
UseAAVTagsFAPdL5-POST, T2A-dTomato, and mycPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-RAB11a KI
Plasmid#131499PurposeEndogenous tagging of RAB11: N-terminal (amino acid position: before startcodon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
OA-1136J
Plasmid#153023PurposeExpress His-MBP-TEV-CasRx recombinant proteinDepositorInsertCasRx
TagsHis-MBP-TEVExpressionBacterialPromoterT7Available SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only