We narrowed to 12,778 results for: NUC
-
Plasmid#173940PurposeBacterial expression of PARP1 lacking WGR domainDepositorInsertPARP1delWGR (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 521-660; V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIRES-hrGFP II-mTET1
Plasmid#83569PurposeExpresses TET1 with a mutated catalytic domain in mammalian cellsDepositorInsertTet Methylcytosine Dioxygenase 1 (TET1 Human)
Tags3X FLAG tag and hr GFP IIExpressionMammalianMutationcatalytic domain mutant H1672D, D1674APromoterCMVAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-TEV-U1AF37MF77M
Plasmid#168267PurposeExpresses human dmU1A with the F37M/F77M double mutantDepositorInsertU1A RRM1 crystallization module (SNRPA Human)
Tags6xHis tag N-terminus, TEV protease cleavage siteExpressionBacterialMutationchanged F37M and F77MPromoterT7 promotorAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2842 pPB: CAG-GID1-VPR-IRES-Zeo-WPRE PGK-GAI-tagBFP-SadCas9
Plasmid#84244PurposeExpresses GA-inducible VPR-Sa dCas9DepositorInsertsGAI-tagBFP-Sa dCas9
GID1-VPR
UseCRISPR and Synthetic Biology; PiggybacTagsGAI-tagBFP-Nucleoplasmin NLS, GID1, IRES-Zeocin, …ExpressionMammalianMutationD10A, N580A and Synonymous mutation in PYL1 to re…PromoterCAG and PGKAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-PKHD1-myc
Plasmid#108407PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human polyduction/fibrocystin expression.DepositorAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha1 P35S:PhiC31 integrase-RDF:T35S (GB2893)
Plasmid#160633PurposeTU for the constitutive expression of the PhiC31 integrase, C-terminally fused with its reversion factor (RDF)DepositorInsertPhiC31-RDF
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoter35SAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT-Flag-NRBP1
Plasmid#48197PurposeExpressed flag-tagged NRBP1 (nuclear receptor binding protein 1)DepositorAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLL4 sgRNA(MS2)-MS2-hA3a
Plasmid#112130Purposeempty sgRNA cloning vector with MS2-humanA3aDepositorAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT/FLAG/HA-DEST EIF2C1
Plasmid#19887DepositorInsertEukaryotic translation initiation factor 2C, 1 (AGO1 Human)
TagsFLAG/HAExpressionMammalianAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook3
Plasmid#198525PurposeExpression of GAL4 DNA-binding domain (BD)-Hook3 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook3 (HOOK3 Human)
TagsGAL4-DNA binding domain (BD) fragmentExpressionYeastPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-GFP-PKHD1
Plasmid#108408PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human polyduction/fibrocystin expression.DepositorAvailable SinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg
Plasmid#73073Purposehuman E2F7 minigene (exons 11,12,13/introns cassette)DepositorInsertE2F7 (E2F7 Human)
ExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by intronsPromoterCMVAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET22b-mEB2-eGFP-6xHis
Plasmid#130982PurposeBacterial expression of mouse EB2-GFP-6xHis for protein purification.DepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR201-Eps8L2
Plasmid#196526PurposeEntry vector for Gateway with Eps8L2DepositorAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delZn3
Plasmid#173936PurposeBacterial expression of PARP1 lacking Zn3 domainDepositorInsertPARP1delZn3 (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 214-373; V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET22b-mEB3-mCherry-6xHis
Plasmid#130985PurposeBacterial expression of mouse EB3-mCherry-6xHis for protein purification.DepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PITX3-2A-eGFP-PGK-Puro
Plasmid#31943DepositorAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLV Gpat4-V5
Plasmid#175145PurposeLentiviral expression of mouse Gpat4-V5DepositorAvailable SinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
KAT6B-Tol2
Plasmid#113384Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of KAT6B geneDepositorInsertKAT6B-enhancer (KAT6B Human)
UseTol2 reporterAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only