We narrowed to 9,182 results for: Pol
-
Plasmid#135557PurposeExpress mouse Rab10wt in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Rab10wt.DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-BNT162b2ΔUTR
Plasmid#171214PurposeGateway entry vector containing the BNT162b2/tozinameran cDNA sequence lacking the original 5' and 3' UTRs and the poly(A) tail. The original Kozak sequence has also been altered.DepositorInsertBNT162b2ΔUTR
UseGateway cloningMutationKozak sequence changed from CCCGCCACC to GGCTGCAC…Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 Lysosomal-METRIQ
Plasmid#135401PurposeExpresses lysosomal-METRIQ (DNAse II-sfGFP together with cytosolic RFP) to measure lysosomal activityDepositorInsertDNAse II alpha (DNASE2 Human)
UseLentiviralTagsT2A, mCherry, and sfGFPExpressionMammalianMutationSingle-nucleotide polymorphism C432TAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
p20 Inducible TFs for G-integration: Lex-ER-B112 and ZPM
Plasmid#183150PurposeExpression cassettes for transcription factor induced by estradiol (Lex-ER-B112) or progesterone (ZPM)DepositorInsertsLex-ER-B112
Zif268 DBD - hPRLBD - MSN2AD
UseFor yeast genomic integrationAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCB’
Plasmid#162703PurposepCB reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutation5513T>G (tetR E37A); 7758G>T (second tet op…PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
AV15_pCAG.Cas9.gRNA.S1
Plasmid#199259PurposeExpression construct encoding SpCas9 nuclease and an AAVS1-targeting guide RNADepositorInsertsSpCas9 nuclease
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
6691 Bicistronic_ires_puro
Plasmid#64335PurposeThis a retroviral expression plasmid with a minimal polylinker followed by IRES and puro resistance geneDepositorTypeEmpty backboneUseRetroviralAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET26b_AT118-L-V5-His
Plasmid#222848PurposeE. coli periplasmid expression plasmid encoding Nb. AT118-L, a humanized nanobody antagonist of the human Angiotensin II type I receptor (AT1R) with reduced polyreactivityDepositorInsertAT118-L
TagsV5-HisExpressionBacterialAvailable SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_luciferase
Plasmid#135475PurposeEncodes Marburg virus minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, luciferase reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Kan-HC-EF1a-Nla-Cas8-7-5-11
Plasmid#193752Purposehuman codon optimized Nla-cas8c-Cas7c-Cas5c-Cas11c cloned into pSmart-HC-Kan-EF1a-bGHDepositorInsertEF1a-NlaCas8c-Cas7c-Cas5c-Cas11c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10316:GABR1
Plasmid#157850PurposeHA-TEV-VFT-TMD-CC-PreX-eGFP in pFastBac1 for Sf9 expressionDepositorAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAW212
Plasmid#172196PurposeP1 integration cassette for AT110 Polymerase for integration onto Orthorep for Nanobody evolution with different restriction sitesDepositorInsertp10B2-AT110
ExpressionYeastPromoter10B2 (P1 specific promoter)Available SinceAug. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only