We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTN4
Plasmid#174212PurposeDonor plasmid for introducing Peft-3::AtTIR1(F79G)::mRuby at the ttTi5605 locusDepositorAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Neo_SIK3_CR
Plasmid#108104PurposeLentiviral expression plasmid of human SIK3 cDNA (CRISPR-resistant silent mutation) with neomycin resistance geneDepositorInsertSIK3 (SIK3 Human)
UseCRISPR and LentiviralExpressionMammalianMutationchange guanine 501 to cytosine (silent mutation)PromoterEFS promoterAvailable SinceApril 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Neo-CAG-Flpe-ERT2
Plasmid#68460PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and Neo selection geneDepositorInsertmammalian-codon-optimized Flpe recombinase fused with ERT2
UseSynthetic BiologyTagsERT2ExpressionMammalianPromoterCAGAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.4RT4-Pct5.1-crRNA(cgr2)-RT(Δcgr12)
Plasmid#191650PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(cgr2-targeting spacer) cgr1/cgr2-deleting repair template, used for cgr1/cgr2 deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Blasticidin-CAG-Flpe-ERT2
Plasmid#68461PurposeAAVS1 targeting donor plasmid with Flpe-ERT2 expression cassette and blasticidin selection geneDepositorInsertmammalian-codon-optimized Flpe recombinase fused with ERT2
UseSynthetic BiologyTagsERT2ExpressionMammalianPromoterCAGAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-HA-mCherry-pA
Plasmid#233029PurposeTo Express HA Tagged hfCas13d-mCherry fusion protein from the mammalian EFS promoterDepositorInserthfCas13d-mCherry
UseAAVTagsmCherryAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-CMV-intron-CasRx-pA
Plasmid#192485PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato SOX2-sgRNA
Plasmid#196190PurposeEditing human SOX2 locusDepositorInsertSOX2 (SOX2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Orco-T2A-QF2-9xQUAS-GCaMP6f-3XP3-dsRed
Plasmid#157974PurposeTemplate plasmid for inserting GCaMP reporter into the Orco gene of Aedes aegypti with CRISPR/Cas9DepositorInsertOrco
ExpressionInsectAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9-KKH-Puro
Plasmid#135966PurposeExpresses SauriCas9-KKH and puromycin resistance genes, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDB2-hPER1-Luciferase-CD4-bla
Plasmid#189981PurposeDonor Vector to integrate firefly Luciferase C-terminal into the human PER1 Locus to express it as a fusion proteinDepositorInsertLuciferase
UseCRISPRTags3xFlagAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6 SgRNA RBM20
Plasmid#162735PurposeMammalian expressionDepositorInsertSpacer sequence for RBM20
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
L2_lacZgRNA-Cas9-CsA
Plasmid#136138PurposePlasmid to accept gRNA target with SapI, lacZ blue-white screening. Contains Cas9 and HygR.DepositorInsertp5-35Sx2:HygR p5-MpU6:lacZgRNA p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-pA
Plasmid#192488PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minCMVe-SCP1-SaCas9-W3SynpA
Plasmid#231370PurposeSCP1 promoter-driven SaCas9 with truncated CMV enhancer and short synthetic terminator sequence.DepositorInsertSaCas9
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDC175
Plasmid#103019PurposeS. cerevisae centromic plasmid harboring Fncpf1 under control of TEF1 promoterDepositorInsertFncpf1
Tags3HA and NLSExpressionYeastMutationhuman codon optimizedPromoterTEF1Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only