We narrowed to 20,982 results for: OMP
-
Plasmid#115818PurposeEncodes codon optimized 3xFLAG-SIVLST Vpr (AF188116) and puromycin resistance proteinDepositorInsertSIVLST Vpr (AF188116)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-MND1 vpr
Plasmid#115817PurposeEncodes codon optimized 3xFLAG-SIVMND1 Vpr (M27470) and puromycin resistance proteinDepositorInsertSIVMND1 Vpr (M27470)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
myc-hIFITM3-F63Q
Plasmid#104363PurposeExpresses human IFITM3-F63Q with an N-terminal myc tag in mammalian cells.DepositorInsertIFITM3 (IFITM3 Human)
TagsmycExpressionMammalianMutationmutated the following amino acid: F63QPromoterCMVAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SLA2-1/1
Plasmid#91450PurposeProtein expression and purification of human SH3 domain construct SLA2-1/1DepositorInsertSLA2-1/1 (SLA2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NCK2-2/3
Plasmid#91362PurposeProtein expression and purification of human SH3 domain construct NCK2-2/3DepositorInsertNCK2-2/3 (NCK2 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPAtUbq10 (GB0223)
Plasmid#68174PurposeProvides the Arabidopsis thaliana polyubiquitin 10 promoter as a level 0 GoldenBraid partDepositorInsertAtUbq10 promoter
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'UAG)
Plasmid#170128PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceMay 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V460P
Plasmid#61379PurposeExpresses Human full length RIPK3 with V460P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V460Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V460 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-hRIP3-FL V458P
Plasmid#61377PurposeExpresses Human full length RIPK3 with V458P mutation in the mammalian cellsDepositorInsertFull length human RIP3 with V458Pmutation (RIPK3 Human)
TagsEYFPExpressionMammalianMutationchanged V458 to PAvailable SinceJan. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmCup_C
Plasmid#146041PurposeInsect Expression of DmCupDepositorAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG-2
Plasmid#172739PurposeBacterial expression of HIS-tagged anti-GFP nanobody LaG-2; HIS tag preceded by HRV 3C/PreScission cleavage site.DepositorInsertLaG-2
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pILGFP86
Plasmid#83543PurposeUsed to evaluate the expression output of RPL4A promoter with yEGFP used as the reporter gene.DepositorInsertRPL4A promoter-yEGFP
ExpressionYeastPromoterRPL4AAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc-mCE(K294A)
Plasmid#82461PurposeExpression of myc epitope and catalytic inactive form of murine mRNA Capping Enzyme (K294A) in mammalian cellsDepositorInsertmCE (K294A) (Rngtt Mouse)
TagsmycExpressionMammalianMutationLysine 294 changed to AlaninePromoterCMVAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUPD_OsU3 (GB1184)
Plasmid#68209PurposeProvides the O. sativa U3 RNA polIII promoter as a level 0 GoldenBraid partDepositorInsertOsU3 promoter
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_NCK1-1/3
Plasmid#91472PurposeProtein expression and purification of human SH3 domain construct NCK1-1/3DepositorInsertNCK1-1/3 (NCK1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO DNAJB7
Plasmid#19476DepositorInsertDNAJB7 (DNAJB7 Human)
ExpressionMammalianAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0112
Plasmid#117548PurposeLevel 1 Golden Gate Cassette: xCas9 3.7 expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + Sp-xCas9 3.7 (no stop codon) (pEPOR0SP0011) + YFP (pICSL50005) + Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
CBM9-ID-F
Plasmid#171639PurposeExpresses SARS-CoV-2 Spike epitopeDepositorAvailable SinceJuly 19, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits