We narrowed to 9,093 results for: Set
-
Plasmid#137165PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND Flp AND VcreDepositorInsert3x-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEf1aAvailable SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pv6_MECP2_MBD
Plasmid#179407PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of MECP2_MBDDepositorAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-MAPRE1
Plasmid#207794PurposeDonor template to insert moxGFP-2A-Puro into the C-terminus of the MAPRE1 locus for growing microtubule tip visualization. To be co-transfected with sgRNA plasmid px330-PITCh-MAPRE1 Addgene #207793DepositorInsertMAPRE1 Homology Arms flanking a moxGFP-Puro Cassette (MAPRE1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-mScarlet-ACTB
Plasmid#207754PurposeDonor template for Puro-2A-mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mScarlet Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEM-NLS-BirA-2A-mCherry-SV40pA-FKF
Plasmid#79889PurposeDonor cassette containing HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), mCherry protein and SV40 polyA tail, followed by FRT site-flanked Kanamycin selection geneDepositorInsertHA-tagged NLS-BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
ExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT1-His-H2B-Cherry-2A (IG156)
Plasmid#99622PurposeTo clone gene of interest downstream of FRT1-His-H2B-Cherry-2A cassetteDepositorInsertHis-H2B-Cherry
ExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
FRT2-H2B-EGFP-V5-2A (IG157)
Plasmid#99623PurposeTo clone gene of interest downstream of FRT2-H2B-EGFP-V5-2A cassetteDepositorInsertH2B-EGFP-V5
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mc4r->M71-IRES-tauGFP ACNF TV
Plasmid#105072PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-333 of Mc4r and an IRES-tauGFP followed by ACNF cassetteDepositorInsertMc4r->M71-IRES-tauGFP-ACNF (Mc4r Mouse)
UseMouse TargetingAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
FRT3-HA-H2B-Cerulean-2A (IG158))
Plasmid#99624PurposeTo clone gene of interest downstream of FRT3-HA-H2B-Cerulean-2A cassetteDepositorInsertHA-H2B-Cerulean
TagsT2AExpressionMammalianAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMA-RQ-PNPLA3-I148M
Plasmid#255037PurposeUsed to confer expression of PNPLA3 with the isoleucine 148 residue replaced with a methionineDepositorInsertPatatin-like Phospholipase domain-containing 3 (PNPLA3) (PNPLA3 Human)
ExpressionMammalianMutationMutated isoleucine 148 to methionine (I148M); rec…Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lentivirus ABE8e-V106W with non-targeting sgRNA
Plasmid#247668PurposeLentivirus genome encoding ABE8eV106W editor and Sp sgRNA cassette non-targeting controlDepositorInsertABE8e-V106W and non-targeting sgRNA
UseLentiviralExpressionMammalianPromoterEFSAvailable SinceApril 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Af1521(K35E/Y145R)-myc
Plasmid#196237PurposeAf1521(K35E/Y145R) macrodomain with a myc tag fused to the C terminus & a hygromycin resistance cassetteDepositorInsertAf1521(K35E/Y145R) encoding a C-terminal myc tag
UseLentiviralTagsmyc tagExpressionMammalianMutationamino acid 35 lysine is replaced with glutamic ac…PromoterEF1AAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TNT4-Zfr-P2A-HA-luciferase
Plasmid#223188PurposePlasmid containing the Zfr/Firefly luciferase cassette. Translation of luciferase is controlled by splicing modulation of the Zfr by risdiplam.DepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA1
Plasmid#232623PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA2
Plasmid#232624PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-chr20-49345720-gRNA3
Plasmid#232625PurposeLentiviral plasmid expressing gRNA targeting the enhancer region in Chr20:49345720 (hg38) locus with lentiGuide-Hygro-eGFP (Addgene #99375) as backbone.DepositorInsertS. pyogenes sgRNA cassette
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Luciferase-P2A-H2A-mCherry (JDW 1129)
Plasmid#229823PurposeA CAGGS driven luciferase reporter followed by a P2A cleavage peptide and an H2A mCherry cassette for nuclear labeling.DepositorInsertLuciferase-P2A-H2A-mCherry
ExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only