We narrowed to 41,013 results for: Eras
-
Plasmid#178669PurposeBacterial expression of N-terminally 6His tagged A1-LCD with three Arg residues replaced with Lys (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD-3R+3K (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationthree Arg residues replaced with LysAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+7F-7Y
Plasmid#178660PurposeBacterial expression of N-terminally 6His tagged A1-LCD with seven Tyr residues replaced with Phe (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD +7F-7Y (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationseven Tyr residues replaced with PheAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD+12E
Plasmid#178676PurposeBacterial expression of N-terminally 6His tagged A1-LCD with twelve Glu residues added (LCD: low-complexity domain, aa 186-320)DepositorInsertA1-LCD+12E (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationtwelve Glu residues addedAvailable SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV hCgrrf1-V5
Plasmid#175129PurposeLentiviral expression of human CGRRF1-V5DepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV mCgrrf1-V5
Plasmid#175128PurposeLentiviral expression of mouse Cgrrf1-V5DepositorAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBIG1b_nsp7 (SARS-CoV-2)
Plasmid#169178PurposeBaculoviral transfer vector to express untagged nsp7 (SARS-CoV-2) in insect cellsDepositorInsertnsp7 (ORF1ab SARS-CoV-2, Synthetic)
TagsuntaggedExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1c_nsp8 (SARS-CoV-2)
Plasmid#169179PurposeBaculoviral transfer vector to express untagged nsp8 (SARS-CoV-2) in insect cellsDepositorInsertnsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsuntaggedExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNIA-CEN-FLAG-LANS1-Set2
Plasmid#122002PurposeFLAG-LANS-Set2: FLAG-tagged LANS1-Set2 for light control of Set2 localization in yeastDepositorInserthistone methyltransferase SET2 (SET2 Budding Yeast)
UseSynthetic BiologyTagsFLAGExpressionYeastMutationSet2 point mutations K538G, K539S, R549G, K550S, …PromoterADH1Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_5
Plasmid#155063PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and four intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-DelFSH(307-309)-pKK223
Plasmid#131377PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with deletion of residues FSH 307-309 in Gs MutY.DepositorInsertEcNGsC MutY chimera DelFSH(307-309)
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308P-H309D-pKK223
Plasmid#131378PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid changes S308P and H309D in Gs MutY.DepositorInsertEcNGsC MutY chimera S308P H309D
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-S308A-pKK223
Plasmid#131379PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid changes F307A and S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway cloning vectorAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA2_LC_D290V_S285C
Plasmid#98666PurposeExpresses 6xHis-tagged hnRNPA2 AA 190-341 with S285C and D290VDepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only