We narrowed to 14,742 results for: RING
-
Plasmid#216211Purposefor expression of human GFP-tagged SGLT2-MAP17 nanobody complex in BacMam systemDepositorTagsGFPExpressionMammalianAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pK18msB
Plasmid#177839PurposePlasmid for gene replacement using kanamycin/sucrose selection/counterselection. Derived from pK18mobsacB but reduced in size.DepositorTypeEmpty backboneUseBacterial gene replacementAvailable SinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Actin-7
Plasmid#56421PurposeLocalization: Actin, Excitation: 488, Emission: 507DepositorAvailable SinceDec. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
7xE-Box::Renilla
Plasmid#124532Purposec-Myc Renilla luciferase reporterDepositorInsertc-Myc Renilla reporter
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable SinceJune 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-NE2h-IRES-mCherry-CAAX
Plasmid#208691PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2h and a membrane-localized mcherry in mammalian cellsDepositorInsertGPCR activation based norepinephrine (NE) sensor GRAB_NE2h
ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCI H2B-RFP
Plasmid#92398PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), MCS and IRES controlled Histone2B-mRFP1 reporter.DepositorInsertIRES H2B RFP
ExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
eforRed chromoprotein
Plasmid#117837PurposeBioBrick pSB1C3 plasmid that constitutively overexpresses eforRed chromoprotein in E. coliDepositorInsertpromoter, RBS, eforRed
UseSynthetic Biology; Escherichia coliMutationBioBrick sites removedAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPL7552_ColE1_PiggyBac_2xcHS4::mCherry-IRES-PuroR-P2A-mTagBFP2-NLS::2xcHS4
Plasmid#217971PurposeProvides expression from a CMV promoter surrounded by insulators. Integrates via piggyBac transposase. Confers puromycin resistance. Expresses nuclear localized BFP. High copy plasmid.DepositorInsert2xcHS4::mCherry-IRES-PuroR-mTagBFP2-NLS::2xcHS4
ExpressionMammalianAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL1765 (pSPIN-R, R*MmeI)
Plasmid#160734PurposeSingle-plasmid V. cholerae CAST. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA with BsaI sites. Reverse (R) order minimizes self-targeting; MmeI site for Tn-seq; pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV301
Plasmid#204969PurposeAMA1 plasmid with Aspergillus optimized Mad7 and ble (bleomycin) resistance markerDepositorInsertsMad7
ble (bleomycin resistance marker)
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus nidulans tef1 promoter and Aspergillu…Available SinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
Vim-mCh-FKBP
Plasmid#240423PurposeTagged vimentin for rapalog induced pulling experiments.DepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSF3-ultraID
Plasmid#172878Purposeexpresses ultraID in mammalian cells with the tet-on or tet-off systemDepositorInsertultraID
UseLuciferase and Retroviral; To be used in a tet-on…TagsmycExpressionMammalianMutationfragment ([aa2-171]) of aquifex aeolicus BirA wit…PromoterTRE-cmvAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
HA-KIF5A-FRB
Plasmid#240425Purpose+end oriented kinesin for rapalog induced pulling experiments.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCL/IFNB1-d2eGFP-3’UTR
Plasmid#180232PurposeReporter plasmid utilizing d2eGFP as a reporter gene. Expression is designed to mimick IFNB1DepositorInsertd2eGFP
UseLentiviralPromoter1 kb upstream of IFNB1 CDSAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO(ChRger2-TS-YFP)
Plasmid#127239PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CAG promoter and double floxed.DepositorInsertChRger2-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianPromoterCAGAvailable SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGK-H2BeGFP
Plasmid#21210DepositorAvailable SinceJuly 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
CMV-Hylight-T152E
Plasmid#193448PurposeA binding-dead fluorescent biosensor for fructose 1,6-bisphosphate (FBP) for negative control experiments (mammalian expression vector)DepositorInsertBinding-Dead Hylight
ExpressionMammalianMutationThreonine 67 (ACT) mutated to a Glutamic Acid (GA…PromoterCMVAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
[#GS16-LV] Syn1-MitoTRACER - Donor
Plasmid#233565PurposeLentiviral construct of the MitoTRACER genetic reporter to be expressed in the donor cells under the Synapsin1 promotorDepositorInsertMitoTRACER-Donor
UseLentiviral and Synthetic BiologyTagsGFP11 and HA TagExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-HA-hYTHDC1
Plasmid#85167PurposeExpression of FLAG-HA-tagged human YTHDC1DepositorAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only