We narrowed to 11,081 results for: AGA
-
Plasmid#75129PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-RPB1-N-term
Plasmid#195112PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-RPB1-N-term
Plasmid#195110PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting the RPB1 N-term. Puromycin selection (2A-fusion).DepositorInsertsgRNA against first exon of RPB1 (N-terminal)
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM6A_2
Plasmid#86308PurposeEncodes gRNA for 3' target of human KDM6ADepositorInsertgRNA against KDM6A (KDM6A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA2-CTCF-prom
Plasmid#195104PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-CTCF-prom
Plasmid#195103PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAf-CRISPR-phoA
Plasmid#207991PurposeCRISPR vector used with pAf-CRISPR-ctfR1 (#207992) to delete both aflatoxin and cyclopiazonic acid gene clusters of Aspergillus flavusDepositorInsertphoA
UseCRISPRPromoterAspergillus flavus U6Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtm/Cre
Plasmid#89643PurposeExpresses an Atm-targeting gRNA and Cre-recombinaseDepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Bmal1
Plasmid#168296PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgBmal1-1-hU6-sgBmal1-3
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
plKO.1-DNAJC5-ShRNA
Plasmid#205729PurposeKnockdown of DNAJC5DepositorInsertshRNA targeting DNAJC5 (DNAJC5 Human)
UseLentiviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_1
Plasmid#86299PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1045C
Plasmid#125005PurposeExpresses gRNAs targeting hid, eve, and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_2
Plasmid#86300PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA2
Plasmid#201615PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only