167,150 results

#209512

Cloning in complete guide expression cassettes, with Cas12a (D156R)

Wendy Harwood, Cristobal Uauy

Lawrenson et al Research Square, 12 March 2024, PREPRINT

Nov. 9, 2023

Academic Institutions and Nonprofits only

#66235

Expression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocation

Bryan Roth

Kroeze et al Nat Struct Mol Biol. 2015 May;22(5):362-

Sept. 15, 2015

Academic Institutions and Nonprofits only

#55069

Localization: Nuclear Envelope, Excitation: 587, Emission: 610

Michael Davidson

Oct. 7, 2014

Academic Institutions and Nonprofits only

#136035

Scrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#187910

Mammalian cell expression of EGFP-tagged Ubiquitin

Erika Holzbaur

Harding et al Mol Cell. 2023 Sep 7;83(17):3188-3204.e7

April 2, 2024

Academic Institutions and Nonprofits only

#29767

Steven Vogel

Covian-Nares et al J Cell Sci. 2010 Jun 1. 123(Pt 11):1884-

Sept. 19, 2011

Academic Institutions and Nonprofits only

#31786

Xin Chen

Tward et al Proc Natl Acad Sci U S A. 2007 Sep 11;10

Oct. 21, 2011

Academic Institutions and Nonprofits only

#84477

guide RNA expression lentiviral construct

Rudolf Jaenisch

Liu et al Cell. 2016 Sep 22;167(1):233-247.e17. do

Nov. 8, 2016

Academic Institutions and Nonprofits only

#158457

Constitutive lentiviral expression of human TMPRSS2.

Alejandro Chavez, Sho Iketani

Feb. 10, 2021

Academic Institutions and Nonprofits only

#225663

Lentivirus protein expression. Matched control construct for 8522-M31-663 (Addgene # 225661) gives basal expression from mCMVp for gating/thresholding

Dominic Esposito

Tang et al Stem Cell Reports. 2015 Jan 13;4(1):155-

Jan. 16, 2025

Academic Institutions and Nonprofits only