We narrowed to 8,679 results for: sgRNA
-
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-DR-SgRNA-DR-EF1a-mCherry-SV40
Plasmid#154002PurposeEmpty SgRNA expression system matching CasRxDepositorInsertSgRNA expression system
UseCRISPRPromoterU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLb-Cpf1-pGL3-U6-sgRNA
Plasmid#107682PurposeExpresses LbCpf1 crRNA in mammalian cellsDepositorInsert
ExpressionMammalianAvailable SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 Synthetic, Human, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
U6-(BbsI)sgRNA_CAG-Venus-bpA
Plasmid#86985PurposeFor cloning and expression of sgRNA together with Venus expressionDepositorInsertVenus
ExpressionMammalianMutationVenus GFP variantPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNA500
Plasmid#149576Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHKMC1: Empty sgRNA for Cloning
Plasmid#67720PurposeEmpty vector for cloning sgRNA. NotI and BamHI for cloning sgRNA. PU6 driven sgRNA.DepositorTypeEmpty backboneExpressionWormPromoterPU6Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(W-)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102797PurposeRetrovirus for testing CRISPR KO activity (empty) - non-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ148-BhCas12b-sgRNA-scaffold
Plasmid#122448PurposeExpresses sgRNA for BhCas12b in mammalian cellsDepositorInsertU6-BhCas12b-sgRNA-scaffold, CMV-mCherry
ExpressionMammalianAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L3L2
Plasmid#113740PurposeGateway entry vector containing attL3 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L4
Plasmid#113736PurposeGateway entry vector containing attL1 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDM002-sgRNA-lenti-ZeoR
Plasmid#200060PurposeLentiviral vector for expression of sgRNA with mCherry, zeocin resistance, BlpI + BstXI cloning sitesDepositorInsertBleomycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceJuly 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 1
Plasmid#131345PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMulti-sgRNA-LacZ-DsRed
Plasmid#99914PurposeReceptor plasmid for the assembly of multiple sgRNAs with DsRed coexpressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only