We narrowed to 16,007 results for: grna
-
Plasmid#115487PurposeCRISPR Cas9 SunTag system to target NtDRMcd to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133D
Plasmid#69289PurposeGolden Gate entry vector; 1st gRNA under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ146-ZmUbi-tRNA
Plasmid#158404PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ136-tRNA2.0; assembly of 6 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX335-EN477
Plasmid#86232PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse CTCF locus. Use together with pX335-EN475.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspCas9-nickase and sgRNA against mouse CTCF STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330 Ctnnb1.2
Plasmid#59912PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCtnnb1 (Ctnnb1 Mouse)
UseCRISPRExpressionMammalianAvailable sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pH1v1
Plasmid#60244PurposegRNA expression by the H1 promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 promoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo sgTREX1
Plasmid#127645PurposeKnock-out of human TREX1 with NeoRDepositorInsertTREX1 sgRNA (TREX1 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133A2.0
Plasmid#99891PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426*-SpSgH
Plasmid#136993PurposeHelper plasmid for SpCas9 gRNA cloning and expressionDepositorTypeEmpty backboneExpressionYeastPromoterSNR52Available sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK372
Plasmid#114687PurposesgRNA targeting NuMA's C-terminal locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNuMA sgRNA
Available sinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN10
Plasmid#114386PurposeEmpty gRNADepositorTypeEmpty backboneUseCRISPRAvailable sinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ132-tRNA
Plasmid#179211PurposeGolden Gate entry vector; 2nd gRNA with tRNADepositorTypeEmpty backboneUseCRISPRPromoterno promoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRU325
Plasmid#167676PurposeIntermediate vector for eight gRNAs using GoldenGate, contains ccdB and attL1-L2 sites for GatewayDepositorInsertattL1-ccdB-attL2
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorAvailable sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by