-
Plasmid#193208PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col22a1 geneDepositorInsertsgCol22a1#2 (Col22a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#1/Cre
Plasmid#193200PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorInsertsgAdgb#1 (Adgb Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAdgb#2/Cre
Plasmid#193201PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Adgb geneDepositorInsertsgAdgb#2 (Adgb Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol22a1#1/Cre
Plasmid#193207PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col22a1 geneDepositorInsertsgCol22a1#1 (Col22a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFlt4#2/Cre
Plasmid#193216PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Flt4 geneDepositorInsertsgFlt4#2 (Flt4 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol11a1#1/Cre
Plasmid#193205PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col11a1 geneDepositorInsertsgCol11a1#1 (Col11a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCol11a1#2/Cre
Plasmid#193206PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Col11a1 geneDepositorInsertsgCol11a1#2 (Col11a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#1/Cre
Plasmid#193209PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorInsertsgCrebbp#1 (Crebbp Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgApc#2/Cre
Plasmid#193202PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Apc geneDepositorInsertsgApc#2 (Apc Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrip1#1/Cre
Plasmid#193203PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Brip1 geneDepositorInsertsgBrip1#1 (Brip1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFlt4#1/Cre
Plasmid#193215PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Flt4 geneDepositorInsertsgFlt4#1 (Flt4 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgGrin2a#1/Cre
Plasmid#193217PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Grin2a geneDepositorInsertsgGrin2a#1 (Grin2a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFam135b#1/Cre
Plasmid#193213PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Fam135b geneDepositorInsertsgFam135b#1 (Fam135b Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti.pFOXA2.GFP
Plasmid#59404Purposeexpresses eGFP from a 400 bp human FOXA2 promoter to select floor plate and ventral midbrain progenitor cells during developmentDepositorInsert400 bp FOXA2 promoter, eGFP (FOXA2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterpFOXA2Available sinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti.pFOXA2.5'.GFP
Plasmid#59407Purposeexpresses eGFP from an about 1350 bp human FOXA2 promoter to select floor plate and ventral midbrain progenitor cells during developmentDepositorInsertapprox. 1350 bp FOXA2 promoter, eGFP (FOXA2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterFOXA2Available sinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…TagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLEX_305-N-dTAG-FRA1
Plasmid#188742Purposeexpresses murine Fosl1 (Fra1) with N-terminal tag FKBP F36V (dTAG) for the dTAG systemDepositorInsertFosl1 (Fosl1 Mouse)
UseLentiviralTagsFKBP F36V tag (dTAG)ExpressionMammalianMutationPromoterhPGK promoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSc1-puro
Plasmid#80438PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cell, and also confers resistance to puromycinDepositorInsertssp Cas9 gRNA
eGFP
Puromycin resistance
UseCRISPRTagsExpressionMammalianMutationPromoterCMV, U6, and hPGKAvailable sinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErich3#1/Cre
Plasmid#193211PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Erich3 geneDepositorInsertsgErich3#1 (4922501L14Rik Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgErich3#2/Cre
Plasmid#193212PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Erich3 geneDepositorInsertsgErich3#2 (4922501L14Rik Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIN-TRE-H2BeGFP-rtTA2
Plasmid#165494PurposeDoxycycline-inducible all-in-one lentivirus vector to express H2BeGFP fusion protein. System for labelling slow-cycling cells in vivo.DepositorInsertHuman histone H2B (H2BC21 Human)
UseLentiviralTagsEGFPExpressionMutation-PromoterTetO-CMVAvailable sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX305_FKBP12F36V-SHOC2
Plasmid#134522PurposeLentiviral plasmid expressing SHOC2 with N-term FKBP12(F36V) tagDepositorInsertSHOC2 (SHOC2 Human)
UseLentiviralTagsFKBP12F36V-2xHAExpressionMammalianMutationSilent mutations made at wobble base position at …PromoterhPGKAvailable sinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BXRF1
Plasmid#37952DepositorInsertBXRF1 (BXRF1 H. Herpesvirus 4 (EBV))
UseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPGKAvailable sinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only