We narrowed to 13,645 results for: sequence
-
Plasmid#191098PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mitoGFP-DIO
Plasmid#174112PurposeCre-dependent expression of mitochondria-targeted Green Fluorescent Protein under control of the EF1a promoterDepositorHas ServiceAAV2InsertmitoGFP (COX8A Human)
UseAAVTagsCox8 targeting sequence and GFPPromoterEf1aAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCS2-FlipGFP(Casp3 cleavage seq) T2A mCherry
Plasmid#124431PurposeExpresses FlipGFP (caspase-3 cleavage sequence) protease reporter and T2A mCherry in zebrafishDepositorInsertFlipGFP(Casp3 cleavage seq) T2A mCherry
UseZebrafish (if expression level is too high in zeb…Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1661-sgMUC4-E3(F+E)
Plasmid#51025PurposeLentiviral vector that contains an optimized S. pyogenes sgRNA targeting the repetitive sequence of human MUC4 exon 3DepositorInsertoptimized sgRNA (MUC4 Mouse, Human)
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3-FlipGFP(Caspase-1 cleavage seq) T2A mCherry
Plasmid#124494PurposeExpresses FlipGFP (caspase-1 cleavage sequence) and T2A mCherryDepositorInsertFlipGFP(Caspase-1 cleavage seq) T2A mCherry
UseSynthetic BiologyAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pUB-HspINTphiC31
Plasmid#127518PurposePlasmid encodes H. sapiens codon optimized Integrase phiC31.DepositorInsertIntegrase phiC31 coding sequence codon optimized for H. sapiens expression.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLDLR-Luc mutSRE
Plasmid#14945DepositorInsertLDLR promoter mut SRE (LDLR Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPoint mutation in the SRE-1 sequence of the LDL r…Available SinceMay 21, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV NA 3C FLAG SA
Plasmid#234993PurposeExpression of transmembrane region of Neuraminidase protein fused to streptavidin protein for displaying on viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1-plus
Plasmid#126768PurposeExpression plasmid for human codon-opt. increased fidelity SpCas9-HF1-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as SpCas9-HF1DepositorInsertSpCas9-HF1-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; Q695A; Q926A; amino acids 1005-1013 replac…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA CFP hNKCC1 WT (NT15-H)
Plasmid#49077PurposeExpresses human NKCC1 with an N-terminal 3xHA-CFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites. Native hNKCC1 amino acid sequenceDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x HA and mCeruleanExpressionMammalianMutation262 silent mutations from native hNKCC1PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFB-Puro-A
Plasmid#192506PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a nd a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInserthU6-sgRNA-CS1-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterhU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmExRai-AKAR2
Plasmid#161755PurposePlasma membrane-targeted ExRai-AKAR2.DepositorInsertLyn-ExRai-AKAR2
TagsN-terminal targeting sequence from Lyn kinaseExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmax
Plasmid#206883PurposeExpresses FLAG-tagged PEmax fused to Gag through a linker sequenceDepositorInsertPEmax
UseCRISPR and LentiviralTagsFLAGPromoterCMVAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKrox24(2xD-E_inD)Luc
Plasmid#200109PurposeLuciferase reporter for in cell monitoring of receptor tyrosine kinase-MAP ERK pathway activityDepositorInsertmodified EGR1 promoter
ExpressionMammalianMutationhighly modified sequencePromoter2 copies of D-E element in front of EGR1 promoter…Available SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-sox10-NLS-BirA-2A-mCherry_Ras
Plasmid#80063PurposeSox10 promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterSox10 promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only